We narrowed to 8,839 results for: sgRNA
-
Plasmid#59911PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pdCas9-DNMT3A-PuroR_hNT
Plasmid#71830PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and non-targeting control sgRNA for use in human cellsDepositorInsertNon-targeting sgRNA human (DNMT3A S. pyogenes, Human, Synthetic)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgEIF3D-4
Plasmid#236766PurposeA piggybac-based vector containing mouse U6 promoter-driven EIF3D sgRNA #4 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertEIF3D sgRNA-4 (EIF3D Human)
UsePiggybacExpressionMammalianPromotermouse U6 promoter and mouse U6 promoter, CAG prom…Available SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2A gRNA (BRDN0001149181)
Plasmid#76414Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2A gRNA (BRDN0001148547)
Plasmid#76415Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MINK1 gRNA (BRDN0001146260)
Plasmid#76260Purpose3rd generation lentiviral gRNA plasmid targeting human MINK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DYRK1A gRNA (BRDN0001145031)
Plasmid#76755Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E4orf6
Plasmid#64220PurposeExpression vector for sgRNA and Cas9 linked via T2A to BFP linked to the Ad4 E4orf6 gene via P2ADepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E4orf6ExpressionMammalianPromoterCBh and U6Available SinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
Plasmid#64219PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked via T2A to BFP linked to the Ad4 E1B55K gene via P2ADepositorInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E1BExpressionMammalianPromoterCBh and U6Available SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
PMXS-GOT1
Plasmid#72872PurposeThe retroviral GOT1 vector was generated by cloning an sgRNA resistant human GOT1 gene block into the pMXS-ires-blast vector by Gibson Assembly.DepositorInsertGOT1 (GOT1 Human)
UseRetroviralExpressionMammalianMutationsgRNA resistant human GOT1, 7 silent mutations c1…Available SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI)
Plasmid#64217PurposeExpression vector for sgRNAs cloned into the BbsI sites, shRNAs into BamHI & AflII and for Expression of Cas9 linked to mCherry via T2ADepositorInsertsCas9
hU6 promoter; BbsI sites for sgRNA
H1 promoter; BamHI site for shRNA
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianPromoterCBh, H1, and U6Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
PINK1 gRNA (BRDN0001147554)
Plasmid#78035Purpose3rd generation lentiviral gRNA plasmid targeting human PINK1DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
PINK1 gRNA (BRDN0001145357)
Plasmid#78036Purpose3rd generation lentiviral gRNA plasmid targeting human PINK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188765PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterSFFVAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
ERN1 gRNA (BRDN0001162231)
Plasmid#76409Purpose3rd generation lentiviral gRNA plasmid targeting human ERN1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001149518)
Plasmid#77529Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
FXN gRNA (BRDN0001144784)
Plasmid#77813Purpose3rd generation lentiviral gRNA plasmid targeting human FXNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FXN gRNA (BRDN0001145648)
Plasmid#77814Purpose3rd generation lentiviral gRNA plasmid targeting human FXNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FXN gRNA (BRDN0001146360)
Plasmid#77815Purpose3rd generation lentiviral gRNA plasmid targeting human FXNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only