We narrowed to 1,548 results for: SIR
-
Plasmid#78116PurposeNt His-tag Mustela putorius furo Sacsin 94-1381DepositorInsertSacsin Mustela putorius furo 94-1381
TagsHis-TagExpressionBacterialAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-SIRPT1-Ceratotherium simum simum
Plasmid#75331PurposeGST fusion Ceratotherium simum simum Sacsin 89-1366DepositorInsertSacsin Ceratotherium simum simum 89-1366
TagsGST-TagExpressionBacterialAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-SIRPT1-Mustela putorius furo
Plasmid#75333PurposeGST fusion Mustela putorius furo Sacsin 94-1381DepositorInsertSacsin Mustela putorius furo 94-1381
TagsGST-TagExpressionBacterialAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-WRAP53beta-siRNA-resistant
Plasmid#64680Purposeexpresses siRNA resistant WRAP53betaDepositorInsertWD40-encoding RNA antisense to P53 (WRAP53 Human)
TagsFLAGExpressionMammalianMutationsiRNA resistantPromoterCMVAvailable SinceMay 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100/125L-siResist
Plasmid#49855PurposeEncodes human connexin 43 with M100 and M125 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationMethionine100 and Methionine 125 mutated to Leuci…PromoterCMVAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed plus 13-16 siRNA
Plasmid#40767PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed plus 13-16 target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant SigmaR1-mNeonGreen R119A F191A
Plasmid#226574PurposeEncodes mutant siRNA resistant SigmaR1 protein (substitutions) labeled with mNeonGreenDepositorInsertSigmaR1 (Sigma-1 Receptor) (SIGMAR1 Human)
TagsmNeonGreenExpressionMammalianMutationR119A, F191AAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant ss-SigmaR1DTM-mNeonGreen R119A F191A
Plasmid#226576PurposeEncodes mutant siRNA resistant SigmaR1 protein (transmembrane region deletion + substitutions) labeled with mNeonGreenDepositorInsertSigmaR1 (Sigma-1 Receptor) (SIGMAR1 Human)
TagsmNeonGreenExpressionMammalianMutationR119A, F191AAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-SIRPB1-COMP5AP-AviTag-9xHis
Plasmid#157344PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRDAX-VALENTIA-021 Lamp1-Sirius//BsaI
Plasmid#130202PurposeEMMA Kit # 1000000119 extensionDepositorInsertLamp1-Sirius
UseSynthetic BiologyAvailable SinceMarch 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-V5-SBP-C1-HsUpf1-del119-272-siRNAres_P
Plasmid#147194PurposeMammalian Expression of HsUpf1-del119-272-siRNAresDepositorInsertHsUpf1-del119-272-siRNAres (UPF1 Human)
ExpressionMammalianMutation4 non silent mutations A69S, K282R, A442G and T1…Available SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-SIRPA-Fc(DAPA)-AviTag-6xHis
Plasmid#156783PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertSIRPA (SIRPA Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-VSIR-Fc(DAPA)-AviTag-6xHis
Plasmid#156555PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertVSIR (C10orf54 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-SIRPB1-Fc(DAPA)-AviTag-6xHis
Plasmid#156780PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertSIRPB1 (SIRPB1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-SIRPB1.3-Fc(DAPA)-AviTag-6xHis
Plasmid#156782PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertSIRPB1 (SIRPB1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-SIRPG-Fc(DAPA)-AviTag-6xHis
Plasmid#156772PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertSIRPG (SIRPG Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-SIRPB2-Fc(DAPA)-AviTag-6xHis
Plasmid#156705PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertSIRPB2 (SIRPB2 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-SIRPD-Fc(DAPA)-AviTag-6xHis
Plasmid#156563PurposeMammalian expression of secreted protein fused to Fc(DAPA)-Avi-6xHis.DepositorInsertSIRPD (SIRPD Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only