We narrowed to 11,658 results for: nar;
-
Plasmid#121808PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + RIP-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream RIP-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + RIP::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-Wing
Plasmid#124552PurposeChimeric ETS domain: Wing of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationThe 5 residues making up the "wing" in …Available SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-H3/S3
Plasmid#124627PurposeChimeric ETS domain: H3/S3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 237 to 241 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q03JI6
Plasmid#103123PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ03JI6 (Cas9 coding gene from Campylobacter jejuni)
UseCRISPR; Cloning vectorTagsSV40NLSMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 Spike (S) Receptor Binding Domain (RBD) library 1
Pooled Library#168776PurposePooled library expressing barcoded SARS-CoV-2 RNA Binding Domain mutationsDepositorExpressionYeastSpeciesSars-cov-2Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 Spike (S) Receptor Binding Domain (RBD) library 2
Pooled Library#168777PurposePooled library expressing barcoded SARS-CoV-2 RNA Binding Domain mutationsDepositorExpressionYeastSpeciesSars-cov-2Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD765 TRE3GV MCS in TU1
Plasmid#139253PurposeTRE3GV promoter and an MCS in TUPV1DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD767 TRE3GV MCS in TU4
Plasmid#139256PurposeTRE3GV promoter and an MCS in TUPV4DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1159 pLink 9
Plasmid#139247PurposeVector that holds the linker for circuits with 9 TUsDepositorInsertLinker9
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1158 pLink 8
Plasmid#139246PurposeVector that holds the linker for circuits with 8 TUsDepositorInsertLinker8
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1157 pLink 7
Plasmid#139245PurposeVector that holds the linker for circuits with 7 TUsDepositorInsertLinker7
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1156 pLink 6
Plasmid#139244PurposeVector that holds the linker for circuits with 6 TUsDepositorInsertLinker6
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1155 pLink 5
Plasmid#139243PurposeVector that holds the linker for circuits with 5 TUsDepositorInsertLinker5
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1154 pLink 4
Plasmid#139242PurposeVector that holds the linker for circuits with 4 TUsDepositorInsertLinker4
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1153 pLink 3
Plasmid#139241PurposeVector that holds the linker for circuits with 3 TUsDepositorInsertLinker3
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1152 pLink 2
Plasmid#139240PurposeVector that holds the linker for circuits with 2 TUsDepositorInsertLinker2
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1151 pLink 1
Plasmid#139239PurposeVector that holds the linker for circuits with 1 TUsDepositorInsertLinker1
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
psfTn5
Plasmid#79107Purposebacterial expression of hyperactive Tn5 transposase carrying E54K and L372P mutationsDepositorInserttransposase 5
TagsHisExpressionBacterialMutationE54K and L372PAvailable SinceMarch 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 Spike (S) Receptor Binding Domain (RBD) library N501Y Tile 2 (positions 437-527)
Pooled Library#174296PurposeThis library contains mutations to SARS-CoV-2 Spike RBD N501Y variant in which all surface exposed residues on S RBD (Tile 2, positions 437-527) were mutated to every other amino acid.DepositorExpressionYeastAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only