We narrowed to 14,243 results for: crispr grnas
-
Plasmid#107055PurposeBackbone vector for cloning in target sgRNA for use with SaCas9 (SauCas9)DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only
-
BC1441-mouse U6-3xsgRNAs (TS5, TS6, TS7)
Plasmid#164040PurposeExpression of three sgRNAs (sgTS5, sgTS6, sgTS7) for targeting to CRISPR-Tag_V2DepositorInsertsgTS5-sgTS6-sgTS7
UseCRISPRPromotermouse U6Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_LMD9
Plasmid#110626PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_CNRZ1066
Plasmid#136651PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:CNRZ1066 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:CNRZ_1066 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_MTH17CL396
Plasmid#136656PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:MTH17CL396 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:MTH17CL396 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_TH1477
Plasmid#136655PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:TH1477 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:TH1477 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_LMG18311
Plasmid#136653PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:LMG18311 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD9:LMG18311 chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRII-BbsI-sgRNAscaffold
Plasmid#159352PurposeExpression vector for a customizable guide RNADepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceNov. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
1203U-U6-gRNA-pCMV-wtCas9-NG-P2A-mcherry-3'dmDR
Plasmid#221448PurposeExpresses wtCas9-NG with double processed direct repeats (15nt) and a non-target spacer in between at 3' end, mCherry tag, and the gRNA targeting HEK293T-site3DepositorInsertswtCas9-NG
mCherry
UseCRISPRExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-ABE-3'UTR-sgRNA-ST2-com vector
Plasmid#136270PurposeExpresses ABE and ST2-com modified sgRNA scaffoldDepositorInsertABE and sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-pegRNA-tetra-com vector
Plasmid#136271PurposeExpresses PE2 and Tetra-com modified pegRNA cassetteDepositorInsertPE2 and pegRNA cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA2-MpCKB
Plasmid#238528PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKB
Plasmid#238527PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKA
Plasmid#238526PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 alphaDepositorInsertMpCKA
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA_PDS
Plasmid#46966PurposeExpresses an sgRNA targeting the PDS gene in Nicotiana benthamiana from the Arabidopsis U6 promoterDepositorInsertAtU6p::sgRNA_PDS
UseCRISPR; Plant expressionAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-non-target
Plasmid#129465PurposeDerived from pSCB2-sgRNA. 20 nucleotide sequence added as sgRNA binding region by inverse PCR. Used as a negative control.DepositorInsertNon-target/random gRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA
Plasmid#86613PurposeVector for tandem expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-Osp.gRNA-MS2in
Plasmid#229772PurposeContains the U6 promoter and an optimized gRNA backbone inserted with two copies of the MS2 stem loop.DepositorInsertgRNA cassette with two MS2 stem loops
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only