We narrowed to 54,518 results for: KAN;
-
Plasmid#114689PurposesgRNA targeting DHC's C-terminal locusDepositorInsertDHC-C sgRNA
Available SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBTK1057
Plasmid#209547PurposeBTK assembled plasmid for integrating a KanR+GFP cassette into the S. alvi genome at a neutral siteDepositorInsertRecombination into the S. alvi wkB2 genome within the SALWKB2_RS11215/SALWKB2_RS11220 intergenic region
UseSynthetic BiologyAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1551
Plasmid#226498PurposepMOBK360_StandVKL: Standard Vector (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protectionDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVP077
Plasmid#222029PurposeEmpty Kanamycin resistant GreenGate destination vector based on pGGP-AG. Domesticated of Esp3I sites in the backbone and chloramphenicol resistance gene.DepositorTypeEmpty backboneUseSynthetic Biology; Greengate compatible cloning v…MutationAll Esp3i sites domesticatedAvailable SinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHBJT017
Plasmid#225168PurposeLow copy cloning vector with same multiple cloning site as pUC19 and pSU19 (AmpR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT024
Plasmid#225175PurposeLow copy cloning vector with same multiple cloning site as pUC18 and pSU18 (SmR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT023
Plasmid#225174PurposeLow copy cloning vector with same multiple cloning site as pUC19 and pSU19 (SmR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT019
Plasmid#225170PurposeLow copy cloning vector with same multiple cloning site as pUC19 and pSU19 (TetR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT020
Plasmid#225171PurposeLow copy cloning vector with same multiple cloning site as pUC18 and pSU18 (TetR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT021
Plasmid#225172PurposeLow copy cloning vector with same multiple cloning site as pUC19 and pSU19 (GmR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT022
Plasmid#225173PurposeLow copy cloning vector with same multiple cloning site as pUC18 and pSU18 (GmR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT016
Plasmid#225167PurposeLow copy cloning vector with same multiple cloning site as pUC18 and pSU18 (ChlR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT015
Plasmid#225166PurposeLow copy cloning vector with same multiple cloning site as pUC19 and pSU19 (ChlR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT018
Plasmid#225169PurposeLow copy cloning vector with same multiple cloning site as pUC18 and pSU18 (AmpR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBTK1054
Plasmid#209544PurposeBTK assembled plasmid for integrating a KanR+E2-Crimson cassette into the S. alvi genome at a neutral siteDepositorInsertRecombination into the S. alvi wkB2 genome w/in the SALWKB2_RS11215/SALWKB2_RS11220 intergenic region
UseSynthetic BiologyAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL0_35 [aadA]
Plasmid#198948PurposeLevel 0 partDepositorInsertaadA
UseSynthetic BiologyAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_64 [mScarlet]
Plasmid#198975PurposeLevel 0 partDepositorInsertmScarlet-I
UseSynthetic BiologyAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_57 [PtetL]
Plasmid#198970PurposeLevel 0 partDepositorInsertPtetL
UseSynthetic BiologyAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_44 [hph]
Plasmid#198957PurposeLevel 0 partDepositorInserthph
UseSynthetic BiologyAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only