We narrowed to 795 results for: PA-GFP
-
Plasmid#75030PurposeRetroviral vector with ubiquitin variant that binds to and occludes the ligand binding site of the 53BP1 Tudor domain (i53)DepositorInsertUbiquitin
UseRetroviralTagsHA and IRES-eGFPMutationUbvG08 with I44A mutation and no terminal GlycinesAvailable SinceJune 30, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMX-HA-UbvG08_MUT-IRES-GFP
Plasmid#75031PurposeRetroviral vector with ubiquitin variant with reverted mutations L69P and V70L (i53-DM mutant)DepositorInsertUbiquitin
UseRetroviralTagsHA and IRES-eGFPMutationUbvG08 with I44A, P69L, and L70V mutations and no…Available SinceJune 30, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-TetO-hNGN2-eGFP-Puro
Plasmid#79823PurposeExpresses human NEUROGENIN2 (hNGN2), eGFP and puromycin resistance gene under control of TetON promoter. This 3rd generation lentiviral vector is used to generate NGN2-iNs from hiPSCs and hiPSC-NPCs.DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-human Igf2bp2-IRES-GFP
Plasmid#91890PurposeRetroviral expression of human Igfbp2DepositorAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
LLPS1-iLID::EGFP::FTH1 (pBS1042)
Plasmid#185289PurposeFor the mammalian expression of the synthetic protein iLID::eGFP::FTH1 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertiLID::eGFP::FTH1
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-mouse Gfi1-GFP
Plasmid#91892Purpose3rd generation lentiviral expression of mouse Gfi1DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F1-GFP
Plasmid#91881PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F2-GFP
Plasmid#91882PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-mouse Ezh2 Y637S-IRES-GFP
Plasmid#91887PurposeRetroviral expression of mouse Ezh2 with Y637SDepositorInsertEzh2 (Ezh2 Mouse)
UseRetroviralTagsIRES-EGFPExpressionMammalianMutationY637SPromoterMMLV gagAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIG-601_NY-ESO-1_TCR_GFP
Plasmid#207482PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertGFP, NY-ESO-1_TCR
UseCRISPRMutationPotential silent point mutation in GFP sequenceAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
372 pTol2-fli1ep:EGFPDest
Plasmid#73491PurposeTol2 vector with fli1ep element upstream of EGFP, attR1/R2 cassette, and late SV40 pA signalDepositorInsertfli1ep:EGFP-attR1-attR2
Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-mouse Gfi1-IRES-GFP
Plasmid#91893PurposeMammalian expression of mouse Gfi1DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-human Erbb2-IRES-GFP
Plasmid#91888PurposeRetroviral expression of human Erbb2DepositorAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-mouse Ezh2 delta SETdomain-IRES-GFP
Plasmid#91885PurposeRetroviral expression of mouse Ezh2 with a SET domain deletionDepositorInsertEzh2 (Ezh2 Mouse)
UseRetroviralTagsIRES-EGFPExpressionMammalianMutationSET domain deletedPromoterMMLV gagAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
ath5:GFP-CAAX
Plasmid#105958Purposetransgenesis, EGFP membraneDepositorInsertCAAX
TagsGFPExpressionBacterialAvailable SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-mouse Gfi1-IRES-GFP
Plasmid#91891PurposeRetroviral expression of mouse Gfi1DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
bactin:GFP-LAP2b
Plasmid#105980Purposetransgenesis, ubiquitous expressionDepositorInsertLAP2b
TagsGFPExpressionBacterialAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only