We narrowed to 869 results for: PA-GFP
-
Plasmid#46838PurposeExpress cGFP transcript ending in the minimal functional MALAT1 triple helixDepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-mMALAT1_3' Mut U1/U2 Sense
Plasmid#46837PurposeExpress cGFP transcript ending in a mutant MALAT1 triple helix which causes the transcript to be degradedDepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN
Plasmid#47353PurposeClock fragment cloned and tagged with VenNDepositorAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC
Plasmid#47364PurposeBmal fragment cloned with Venus tag and used for BiFCDepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMmaPylT_EF1_mCherry_TAG_EGFP
Plasmid#174893Purposeamber suppression reporter mCherry-TAG-EGFP expression, with MmaPylT amber suppressor tRNA cassetteDepositorInsertmCherry and EGFP
ExpressionMammalianPromoterEF1Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gL1HSg1dCas9-KRAB-T2a-GFP
Plasmid#234882PurposeL1HS-silencing plasmid (CRISPRi gRNA1)DepositorInsertL1HS-silencing plasmid (CRISPRi gRNA1)
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pALS2-sfGFP WT
Plasmid#197575PurposeFluorescence control plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-WT and M. alvus Pyl-tRNA(6). p15a origin of replicationDepositorInsertssfGFP WT
M. alvus Pyl-tRNA (6)
TagsHis6ExpressionBacterialPromoteraraC and lppAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Mb-sfGFP WT
Plasmid#197569PurposeExpression of sfGFP WT with Methanosarcina barkeri (Mb) Pyl-tRNA for the encoding of non-canonical amino acids at TAG codons in HEK293 cellsDepositorInsertssfGFP WT
Pyl-tRNA (4 copies)
TagsV5-His6ExpressionMammalianPromoterCMV and U6/H1Available SinceApril 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Ma-sfGFP WT
Plasmid#197567PurposeExpression of sfGFP WT with Methanomethylophilus alvus (Ma) Pyl-tRNA for the encoding of non-canonical amino acids at TAG codons in HEK293 cellsDepositorInsertssfGFP WT
M. alvus Pyl-tRNA (6) (4x copies)
TagsV5-His6ExpressionMammalianPromoterCMV and U6/H1Available SinceApril 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
ARR3tk-eGFP/SV40-mCherry
Plasmid#132360PurposeTo measure transcriptional activity of Androgen ReceptorDepositorInsertAR responsive elements (AR Human)
UseLentiviralAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2CG2-Neurog1-Magneto2.0-p2A-mCherry-pA
Plasmid#74302PurposeExpression of Magneto2.0-p2A-mCherry in Rohon-Beard sensory neurons of the zebrafishDepositorUseZebrafishTagsFLAG, cmcl2::EGFP, and p2A-mCherryMutationTRPV4: delta 760-871PromoterNeurog1Available SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-mouse Gfi1-IRES-GFP
Plasmid#91891PurposeRetroviral expression of mouse Gfi1DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gLacZ dCas9-KRAB-T2a-GFP
Plasmid#234883Purposenon-targeting CRISPRi controlDepositorInsertL1HS gRNA
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pALS2-sfGFP 150TAG
Plasmid#197574PurposeFluorescence selection plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-150TAG and M. alvus Pyl-tRNA(6). p15a origin of replication.DepositorInsertssfGFP 150TAG
M. alvus Pyl-tRNA (6)
TagsHis6ExpressionBacterialMutationN150TAGPromoteraraC and lppAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
MCS-T2a-GFPnls-ER-Cre-ER
Plasmid#200104PurposeVector For TwistDepositorTypeEmpty backboneUseUnspecifiedAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2K-p53DN-T2A-copGFP
Plasmid#109229PurposeFor Tol2 transposon-mediated stable expression of dominant negative p53 and copGFPDepositorInsertdominant negative p53 (Trp53 Mouse)
TagscopGFPExpressionMammalianMutationdominant negative p53PromoterCAGGSAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMX-HA-UbvG08-IRES-GFP
Plasmid#75030PurposeRetroviral vector with ubiquitin variant that binds to and occludes the ligand binding site of the 53BP1 Tudor domain (i53)DepositorInsertUbiquitin
UseRetroviralTagsHA and IRES-eGFPMutationUbvG08 with I44A mutation and no terminal GlycinesAvailable SinceJune 30, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits