We narrowed to 13,367 results for: GFP expression plasmids
-
Plasmid#198210PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 30 amino acids containing an optimal DQNAT sequon followed by a 6x-His tagDepositorInsertsfGFP_DQNAT
Tags6x His Tag and DQNAT glycosylation tagExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst12-GFP
Plasmid#172311PurposeSST interneuron-restricted gene regulatory element GRE12, to drive GFP expression in SST+ interneuronsDepositorInsertSst12
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst22-GFP
Plasmid#172312PurposeSST interneuron-restricted gene regulatory element GRE22, to drive GFP expression in SST+ interneuronsDepositorInsertSst22
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-GFP-LmnB1
Plasmid#164249Purposeretroviral plasmid for GFP-LmnB1DepositorAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40_scFv_GCN4_sfGFP-VPR-GB1_NLS
Plasmid#79373PurposeRecruits VPR to a compatible Cas9 protein for transcriptional activationDepositorInsertGCN4-sfGFP-VPR
UseCRISPRExpressionMammalianAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFAP-Archon-EGFP
Plasmid#187979PurposeExpresses the fluorescent voltage indicator Archon under the GFAP promoterDepositorInsertArchon1-EGFP
UseAAVAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PTEN C124A
Plasmid#50520PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
LLP726_L2_pV01_0I_TMV-tGFP_TCTP-fLUC
Plasmid#192406PurposeTo be a control plasmid that has no Rluc repression (replaced by turboGFP) and should reflect true off state of the circuit.DepositorInsertAct2::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PTEN D92A
Plasmid#50521PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-D134*
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DO-EGFP-WPRE-pA
Plasmid#37085PurposeExpresses EGFP in cells lacking Cre (Cre-Off)DepositorInsertEGFP
UseAAV and Cre/Lox; Cre-offPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 CMV Cyclone-EGFP
Plasmid#247495PurposeAcyclovir-regulated EGFPDepositorInsertEGFP gene with Cyclone insertion
UseSynthetic BiologyExpressionMammalianMutationCyclone was inserted after Glutamine94 of EGFP to…PromoterCMVAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 102TAG 150TAA
Plasmid#154776Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and dual suppression reporter sfGFP 102TAG 150 TAA stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation102TAG 150TAA in GFP reporter, hybrid PylT with A…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only