We narrowed to 37,189 results for: OMP;
-
Plasmid#133773PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only
-
Str-Golgin84_VSVG-SBP-EGFP
Plasmid#65305Purposesynchronize trafficking of Golgin-84 from the Golgi apparatus (RUSH system)DepositorInsertGolgin-84 (GOLGA5 Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
Str-Ii_SBP-mCherry-Golgin84
Plasmid#65304Purposesynchronize trafficking of Golgin-84 from the ER (RUSH system)DepositorInsertGolgin-84 (GOLGA5 Human)
TagsStreptavidin Binding Protein (SBP) and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP2-E148Q_U
Plasmid#147650PurposeMammalian Expression of HsDCP2-E148QDepositorInsertHsDCP2-E148Q (DCP2 Human)
ExpressionMammalianMutationtwo silent mutations compared to the sequence giv…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
Str-Ii_SBP-EGFP-Golgin84
Plasmid#65303Purposesynchronize trafficking of Golgin-84 from the ER (RUSH system)DepositorInsertGolgin-84 (GOLGA5 Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianPromoterCMVAvailable SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-TagRFP-OcsT
Plasmid#71270PurposeEntry clone containing TagRFP. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTagRFP
UseGatewayTags4xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMis1_1B
Plasmid#192079PurposeA pBBR-1 based vector with IncP group plasmid compatibility for expression in Methylorubrum extorquens using rhamnose dependent inductionDepositorInsertsKanR
rhaR
rhaS
pBBR1 rep
ExpressionBacterialAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH_TNF-SBP-EGFP
Plasmid#65282PurposeTNF reporter only (no hook) (RUSH system)DepositorAvailable SinceJune 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH_TNF-SBP-mCherry
Plasmid#65283PurposeTNF reporter only (no hook) (RUSH system)DepositorInsertTNF (TNF Human)
UseLentiviralTagsStreptavidin Binding Protein (SBP) and mCherryPromoterCMVAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MS2-HA-HsNot4_AA
Plasmid#148255PurposeMammalian Expression of HsNot4DepositorInsertHsNot4 (CNOT4 Human)
ExpressionMammalianMutationone silent mutation compared to the sequence give…Available SinceNov. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLS2-YFPc
Plasmid#87166Purposefluorescence complementation assayDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
FLS2-YFPn
Plasmid#87165Purposefluorescence complementation assayDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRL838
Plasmid#70680PurposeThis vector was used to generate a library of ca. 17-kb sequences of clones as part of a genomic sequence strategy and were then used to complement mutations.DepositorTypeEmpty backboneUseCre/LoxAvailable SinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSL0747 (pDonor_L-MmeI)
Plasmid#130647PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene. The mutated left end introduces an MmeI recognition site (used for Tn-seq). Total transposon size = 977 bp.DepositorInsertVchCAST donor DNA (L*)
UseCRISPR; TransposonExpressionBacterialMutationTGTTGATG --> TGTTGGAGAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsDCP1a_G
Plasmid#146400PurposeMammalian Expression of HsDcp1aDepositorInsertHsDcp1a (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and G1716T compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSL0746 (pDonor_R-MmeI)
Plasmid#130646PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene. The mutated right end introduces an MmeI recognition site (used for Tn-seq). Total transposon size = 977 bp.DepositorInsertVchCAST donor DNA (R*)
UseCRISPR; TransposonExpressionBacterialMutationTGTTGATA --> TGTTGGAAAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-HsNot4-GB1His6_AG
Plasmid#148792PurposeBacterial Expression of HsNot4DepositorInsertHsNot4 (CNOT4 Human)
ExpressionBacterialMutationone silent mutation compared to the sequence give…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only