We narrowed to 61,832 results for: tra
-
Plasmid#195861PurposeEncodes chromogenic protein (CP) with nonsense mutation resulting in amber stop codon at amino acid 62. CP inducible with rhamnose in amber suppressor strains.DepositorInsertAmber Chromogenic Protein on pRCPam plasmid
ExpressionBacterialMutationGln62XAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a-baPrs-hdNadV
Plasmid#91950PurposepET28a-baPrs-hdNadV is a bicistronic vector designed for the simultaneous expression of PRS from Bacillus amyloliquefaciens and NadV from Haemophilus ducreyiDepositorInsertsPutative Nicotinamide Phosphoribosyl Transferase (nadV Haemophilus ducreyi, strain: ATCC 27722)
Phosphoribosyl Pyrophosphate Synthetases
ExpressionBacterialMutationchanged Leucine 135 to IsoleucinePromoterT7Available SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLPCX-Cx43-FS-IRES-GFP
Plasmid#65438PurposeMammalian expression of frameshift mutated Cx43 and EGFP separately driven by the ECMV IRES. For transfection or retroviral productionDepositorInsertCx43 (GJA1 Human)
UseRetroviralTagsIRES-GFPExpressionMammalianMutationframeshift (FS) mutation 35delAPromoterCMVAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAR-9.47_VP1,3
Plasmid#74240PurposeOriginal plasmid described in Choudhury et al. 2015 Mol Ther. for production of AAV-AS vectors. Encodes VP1 and VP3 of AAV9.47DepositorInsertsAAV2 Rep
AAV9.47 VP1
AAV9.47 VP3
UseAAVAvailable SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSETC-RdgBbeta-splice variant 1
Plasmid#58276Purposebacterial expression of human RdgBbeta splice variant 1DepositorAvailable SinceAug. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-SOCS6-WT
Plasmid#74496PurposeOverexpression of SOCS6 in mammalian cellsDepositorAvailable SinceMay 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMW76: pET-His-MBP-SUMO-R2Bm-33XTEN- SpCas9(H840A)-SII
Plasmid#209292PurposeExpresses R2Bm-Cas9(H840A) fusion in E. coliDepositorInsertR2
TagsHis, MBP, SpCas9(H840A), StrepII, and bdSUMOExpressionBacterialPromoterT7Available SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCHOP10(dLZ).pCDNA1
Plasmid#21900DepositorInsertCHOP10 (Ddit3 Mouse)
ExpressionMammalianMutationThe coding region of the murine CHOP-10 cDNA was …Available SinceOct. 8, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSB115 - pL2_pSB90_fLUC-I_tGFP-I
Plasmid#123190Purposebinary plant vector for transient tGFP (with intron) and fLUC (with intron) expressionDepositorInsert2x35S::tGFP-I::tNOS 2x35S::fLUC-I::tNOS
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
MO70 - Orai1 EC-Flag
Plasmid#79590PurposeTransient expression and retroviral ExpressionDepositorInsertOrai1 (ORAI1 Human)
UseRetroviralTagsFLAG (inserted between TM3 and TM4 of the protein…ExpressionMammalianPromoterCMVAvailable SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
NET50 pmRFP-N2 (489)
Plasmid#61983Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
NET97 pmRFP-N2 (641)
Plasmid#61994Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSB96 - pL2_pSB90_2x35S::fLUC-I::tNOS
Plasmid#123188Purposebinary plant vector for transient fLUC (with intron) expressionDepositorInsert2x35S::fLUC-I::tNOS and VirGN54D in the vector backbone
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF1304
Plasmid#144293PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_Crz1(19A)_CLASP_RGS2membrane
Plasmid#133085PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.DepositorInsertCrz1*-CLASP
ExpressionBacterial and YeastPromoterpADH1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
NET37 pmRFP-N2 (450)
Plasmid#61980Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NES-tdTomato-LINuS-WPRE
Plasmid#159894PurposeAAV expression of tdTomato fused to LINuS, a light-inducible nuclear localization signalDepositorInsertNES-tdTomato-LINuS
UseAAVExpressionMammalianPromoterEF1α promoterAvailable SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
TAPBPL pEGFP-C3 (1765)
Plasmid#62055Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-V5-Mfsd10
Plasmid#120238PurposeExpresses V5-tagged Mfsd10 in lentiviral vectorDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only