We narrowed to 4,483 results for: ARA-2
-
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-CAG-DIO-EYFP (AAV PHP.V1)
Viral Prep#104052-AAVPHP.V1PurposeReady-to-use AAV PHP.V1 particles produced from pAAV-CAG-DIO-EYFP (#104052). In addition to the viral particles, you will also receive purified pAAV-CAG-DIO-EYFP plasmid DNA. CAG-driven, Cre-dependent expression of EYFP. These AAV were produced with the PHP.V1 serotype, which permits efficient transduction of brain vascular cells. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEYFP (Cre-dependent)Available sinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_NCOA4_RET
Plasmid#205865PurposeExpress mEGFP-tagged fusion protein, NCOA4_RET from patient-derived sequenceDepositorUseTagsmEGFPExpressionMammalianMutationPromoterAvailable sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_NSD1_ZNF346
Plasmid#205870PurposeExpress mEGFP-tagged fusion protein, NSD1_ZNF346 from patient-derived sequenceDepositorUseTagsmEGFPExpressionMammalianMutationPromoterAvailable sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
BATF-GFP HDRT Source (pTR 146)
Plasmid#112015PurposeDNA sequence source for amplifying an HDR template to tag endogenous human BATF gene with GFPDepositorInsertBATF-GFP HDRT (BATF Human)
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX304-EZH1-D745N
Plasmid#203585PurposeExpresses V5-tagged mutant version of EZH1 partially resistant to JQ-EZ-05 in mammalian cells.DepositorInsertEZH1 (EZH1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationchanged Aspartic Acid 745 to Asparagine for parti…PromoterCMVAvailable sinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-flag-RAP1B-N17-puro
Plasmid#156169PurposeLentiviral vector for expression of flag-RAP1B-N17, with puromycin selectionDepositorInsertRAP1B (RAP1B Bovine)
UseLentiviralTags2xFLAGExpressionMammalianMutationchanged Serine 17 to AsparaginePromoterhuman PGKAvailable sinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-RAP2A-N17-puro
Plasmid#156172PurposeLentiviral vector for expression of RAP2A-N17, with puromycin selectionDepositorInsertRAP2A (RAP2A Human)
UseLentiviralTagsnoneExpressionMammalianMutationchanged Serine 17 to AsparaginePromoterhuman PGKAvailable sinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-Cdc42/N12-Cdc42/13C(Q61L)-FKBP-mVenus-CAAX
Plasmid#214278PurposeExpress split-Cdc42 fragments that are fused with CIDs and FPsDepositorInsertsUseTagsmCerulean (on insert 1) and mVenus (on insert 2)ExpressionMammalianMutationCdc42-Q61LPromoterCMVAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-Cdc42/N12-Cdc42/13C(T17N)-FKBP-mVenus-CAAX
Plasmid#214279PurposeExpress split-Cdc42 fragments that are fused with CIDs and FPsDepositorInsertsUseTagsmCerulean (on insert 1) and mVenus (on insert 2)ExpressionMammalianMutationCdc42-T17NPromoterCMVAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-Rac1/N12-Rac1/13C(Q61L)-FKBP-mVenus-CAAX
Plasmid#214280PurposeExpress split-Rac1 fragments that are fused with CIDs and FPsDepositorInsertsUseTagsmCerulean (on insert 1) and mVenus (on insert 2)ExpressionMammalianMutationRac1-Q61LPromoterCMVAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-Rac1/N12-Rac1/13C(T17N)-FKBP-mVenus-CAAX
Plasmid#214281PurposeExpress split-Rac1 fragments that are fused with CIDs and FPsDepositorInsertsUseTagsmCerulean (N terminal on insert 1) and mVenus (on…ExpressionMammalianMutationRac1-T17NPromoterCMVAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-RhoA/N12-RhoA/13C(T19N)-FKBP-mVenus-CAAX
Plasmid#214283PurposeExpress split-RhoA fragments that are fused with CIDs and FPsDepositorInsertsUseTagsmCerulean (N terminal on insert 1) and mVenus (on…ExpressionMammalianMutationRhoA-T19NPromoterCMVAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_NUP98_NSD1
Plasmid#205873PurposeExpress mEGFP-tagged fusion protein, NUP98_NSD1 from patient-derived sequenceDepositorUseTagsmEGFPExpressionMammalianMutationPromoterAvailable sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Antibody#201865-rAbPurposeAnti-Desmin (Human) recombinant scFv-Fc-fusionDepositorRecommended ApplicationsELISAReactivityHumanSource SpeciesHumanIsotypeIgG1Trial SizeAvailable to purchaseAvailable sinceOct. 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pAAV-hSyn-GRAB_DA1m (AAV9)
Viral Prep#113049-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_DA1m (#113049). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1m plasmid DNA. Synapsin-driven expression of GRAB-DA1m dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h (AAV9)
Viral Prep#113050-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_DA1h (#113050). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1h plasmid DNA. Synapsin-driven expression of GRAB-DA1h dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_ACh3.0 (AAV9)
Viral Prep#121922-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_ACh3.0 (#121922). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_ACh3.0 plasmid DNA. Syn-driven expression of the genetically-encoded fluorescent acethycholine(ACh) sensor GRAB-ACh3.0. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h (AAV Retrograde)
Viral Prep#113050-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-GRAB_DA1h (#113050). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1h plasmid DNA. Synapsin-driven expression of GRAB-DA1h dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only