We narrowed to 11,871 results for: KIN
-
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET Duet1 His6 SUMO D14
Plasmid#177854PurposeBacterial Expression of D14DepositorInsertD14
Tags6xHis-SUMOExpressionBacterialAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
FG11F-C-FLAG-hNKD2
Plasmid#174330Purposeencodes human NKD2 cDNA with a C-terminal FLAG tag in lentiviral vector. Does not encode any fluorescence/resistance marker.DepositorInsertHomo sapiens NKD inhibitor of WNT signaling pathway 2 (NKD2 Human)
UseLentiviralTagsFLAG TagExpressionMammalianPromoterUbCAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
MO70-C-FLAG-hNKD2
Plasmid#174327Purposeencodes human NKD2 cDNA with a C-terminal FLAG tag in retroviral expression vector. Encodes GFP from IRES site and puromycin resistanceDepositorInsertHomo sapiens NKD inhibitor of WNT signaling pathway 2 (NKD2 Human)
UseRetroviralTagsFLAG TagExpressionMammalianPromoterCMVAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-3xFLAG-Puro PAK5 S573N
Plasmid#167195Purposepuromycin resistant lentiviral vector for expression of PAK5 S573NDepositorInsertPAK5 S573N
UseLentiviralExpressionMammalianPromoterUBCAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Flag-stm2585_L139*
Plasmid#174400PurposeS. Typhimurium gene stm2585 (sarA/steE) truncated after 139th amino acid, which removes the stretch homologous to gp130DepositorInsertsarA
TagsEGFP and FlagExpressionMammalianMutationL139* (Truncation after 139th amino acid in sarA)Available SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-SQSfl
Plasmid#171010PurposeHiLITR protease with full-length SQS targeting information (ER)DepositorInsertEGFP-uTEV1-SQS(FL)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRES-EGFP-TPD53
Plasmid#172461PurposeExpression of untagged Tumor Protein D52 like 1 (TPD53/TPD52L1) and GFPDepositorAvailable SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRES-EGFP-TPD54
Plasmid#172459PurposeExpression of untagged Tumor Protein D52 like 2 (TPD54/TPD52L2) and GFPDepositorAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-3xFLAG-Puro PAK5 T538N
Plasmid#167181Purposepuromycin resistant lentiviral vector for expression of PAK5 T538NDepositorInsertPAK5 T538N
UseLentiviralExpressionMammalianPromoterUBCAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-3xFLAG-Puro PAK5 V593I
Plasmid#167179Purposepuromycin resistant lentiviral vector for expression of PAK5 V593IDepositorInsertPAK5 V593I
UseLentiviralExpressionMammalianPromoterUBCAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEBTetDBl-CLIP-Cep72
Plasmid#136869PurposeMammalian expression of the centrosomal protein Cep72 N-terminally fused to CLIP-tagDepositorInsertCLIP-Cep72 (CEP72 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetDBl-CLIP-Cep27
Plasmid#136858PurposeMammalian expression of the centrosomal protein Cep27 N-terminally fused to CLIP-tagDepositorInsertCLIP-Cep27 (HAUS2 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetDBl-CLIP-HsSAS6
Plasmid#136839PurposeMammalian expression of the centrosomal protein SAS6 N-terminally fused to CLIP-tagDepositorInsertCLIP-SAS6 (SASS6 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetBl-CLIP-Cep72
Plasmid#136868PurposeMammalian expression of the centrosomal protein Cep72 N-terminally fused to CLIP-tagDepositorInsertCLIP-Cep72 (CEP72 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetBl-CLIP-Cep27
Plasmid#136857PurposeMammalian expression of the centrosomal protein Cep27 N-terminally fused to CLIP-tagDepositorInsertCLIP-Cep27 (HAUS2 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetBl-CLIP-Cep97
Plasmid#136849PurposeMammalian expression of the centrosomal protein Cep97 N-terminally fused to CLIP-tagDepositorInsertCLIP-Cep97 (CEP97 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetBl-CLIP-γ-tubulin
Plasmid#136848PurposeMammalian expression of the centrosomal protein _-tubulin N-terminally fused to CLIP-tagDepositorInsertCLIP-TUBG (TUBG1 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetBl-CLIP-Sfi1
Plasmid#136842PurposeMammalian expression of the centrosomal protein hSfi1 N-terminally fused to CLIP-tagDepositorInsertCLIP-hSfi1 (SFI1 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetBl-CLIP-α-tubulin
Plasmid#136840PurposeMammalian expression of the centrosomal protein _-tubulin N-terminally fused to CLIP-tagDepositorInsertCLIP-TUBA (DNMBP Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetBl-CLIP-HsSAS6
Plasmid#136838PurposeMammalian expression of the centrosomal protein SAS6 N-terminally fused to CLIP-tagDepositorInsertCLIP-SAS6 (SASS6 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetD-SNAP-Cep72
Plasmid#136820PurposeMammalian expression of the centrosomal protein Cep72 N-terminally fused to SNAP-tagDepositorInsertSNAP-Cep72 (CEP72 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetD-SNAP-Cep57
Plasmid#136818PurposeMammalian expression of the centrosomal protein Cep57 N-terminally fused to SNAP-tagDepositorInsertSNAP-Cep57 (CEP57 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetD-SNAP-α-tubulin
Plasmid#136792PurposeMammalian expression of the centrosomal protein _-tubulin N-terminally fused to SNAP-tagDepositorInsertSNAP-TUBA (DNMBP Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ad-MKP-3 C293S
Plasmid#131525PurposeExpresses MKP-3 with C293S mutation in mammalian cellsDepositorInsertMitogen-activated protein kinase phosphatase 3 (Dusp6 Mouse)
UseAdenoviralTagsNoMutationchanged Cysteine 293 to SerinePromoterCMVAvailable SinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Human INPP5A
Plasmid#129587PurposeExpression of human INPP5A in bacteriaDepositorInsertType I inositol 5-phosphatase (INPP5A Human)
TagsMaltose binding proteinExpressionBacterialAvailable SinceSept. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m7
Plasmid#84726PurposepVR2 but with a G to U mutation immediately following the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
ExpressionBacterialMutationG to U mutation at position 41 of annotated "…Available SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m8
Plasmid#84727PurposepVR2 but with two G to U mutations immediately following the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
ExpressionBacterialMutationG to U mutations at positions 40 and 41 of annota…Available SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m1
Plasmid#84720PurposepVR2 but with a C to U mutation in the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
ExpressionBacterialMutationC to U mutation at position 13 of annotated "…Available SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF215-donor
Plasmid#113804PurposeCRISPR donor plasmid to tag human transcription factor ZNF215 with GFPDepositorInsertZNF215 homology arms flanking EGFP-IRES-Neo cassette (ZNF215 Human)
UseCRISPRMutationrs2239733, rs2239732, hg38:11:6956348:T>G, rs1…Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF211-donor
Plasmid#112382PurposeCRISPR donor plasmid to tag human transcription factor ZNF211 with GFPDepositorInsertZNF211 homology arms flanking EGFP-IRES-Neo cassette (ZNF211 Human)
UseCRISPRMutationhg38:19:57641976:T>C, hg38:19:57641979:A>T,…Available SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF766-donor
Plasmid#112352PurposeCRISPR donor plasmid to tag human transcription factor ZNF766 with GFPDepositorInsertZNF766 homology arms flanking EGFP-IRES-Neo cassette (ZNF766 Human)
UseCRISPRMutationhg38:19:52290357:G>T, hg38:19:52290373:A>G,…Available SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF84-donor
Plasmid#112330PurposeCRISPR donor plasmid to tag human transcription factor ZNF84 with GFPDepositorInsertZNF84 homology arms flanking EGFP-IRES-Neo cassette (ZNF84 Human)
UseCRISPRMutationrs623100, hg38:12:133058872:T>C, hg38:12:13305…Available SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
Flag-Fos S362DS374A
Plasmid#118305PurposeExpression of mous C-FosDepositorAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
Flag-Fos S362AS374D
Plasmid#118304PurposeExpression of mouse C-FosDepositorAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
Flag-Fos S362D
Plasmid#118303PurposeExpression of mouse C-FosDepositorAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLacI-GFP-HEC1-d207
Plasmid#114050PurposeExpression of exogenous LacI-GFP-HEC1 delta 207DepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-LAP-MPS1-d60
Plasmid#114046PurposeExpression of exogenous LAP tagged MPS1 delta 60 (NTE is deleted)DepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
gnu-GFP 9A
Plasmid#113006PurposeP element vector for transposon insertion of gnu-GFP 9A into Drosophila genomeDepositorInsertfull length gnu (gnu Fly)
UseP insertion vectorTagsGFPMutation9 CycB/CDK1 sites mutated to AAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P-1 BICC FL
Plasmid#112998PurposeFor protein expression and purification of full-length Drosophila BicCDepositorInsertfull length BicC (BicC Fly)
ExpressionBacterialAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
full length png in pGEX4t
Plasmid#112974PurposeFor protein expression and purification of full-length Drosophila pngDepositorAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
WNK3 (WNK3B-c005)
Plasmid#110262PurposeBaculovirus expression for structure determination; may not be full ORFDepositorAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
WNK3 (WNK3B-c001)
Plasmid#110261PurposeBaculovirus expression for structure determination; may not be full ORFDepositorAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
WNK2 (WNK2A-c003)
Plasmid#110250PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
PKN2 (PRKCL2A-c038)
Plasmid#110265PurposeBaculovirus expression for structure determination; may not be full ORFDepositorAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe3-A53T
Plasmid#85848PurposeDonor plasmid for SNCA exon3 A53T sequence. Also contains EGFP and tagBFPDepositorInsertSNCA exon 3 homology arms (SNCA Human)
ExpressionBacterial and MammalianAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN19-TIR1-GUS-NOSt
Plasmid#108547PurposeCloning vector including C-terminally GUS-tagged Arabidopsis auxin receptor TIR1 [Wild type] and NOS terminatorDepositorInsertTRANSPORT INHIBITOR RESPONSE 1 fused with GUS and NOS terminator (TIR1 Mustard Weed)
UseCloning vectorTagsGUSAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-dCEN-Incenp
Plasmid#108479Purposeexpression of vsv-dCEN-INCENPDepositorInsertdCEN-INCENP (INCENP Human)
TagsVSVExpressionMammalianMutationCEN box removedPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS315-PGK-SEIPIN2
Plasmid#96987PurposeExpress GFP-tagged Arabidopsis SEIPIN2 gene in yeast cells.DepositorInsertSEIPIN2 (AT1G29760 Mustard Weed)
ExpressionYeastPromoterPhosphoglycerate Kinase (PGK) promoterAvailable SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only