We narrowed to 14,352 results for: Cas9
-
Plasmid#187411PurposeDddA GSVG variantDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDddA GSVG variant
UseCRISPRExpressionMammalianAvailable sinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdCas9+sgRNA expression vector precursor
Plasmid#171798PurposePICASSO: Library expression vector precursor for paired dCas9+sgRNA expressionDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterpLtetOAvailable sinceAug. 16, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV_hUbC-dSpCas9-2xVP64-T2A-BSD
Plasmid#162333PurposeLentiviral expression of dSpCas9-2xVP64 with blasticidin resistanceDepositorInsertdSpCas9-2xVP64
UseLentiviralTagsFLAGExpressionMammalianMutationD10A and H840APromoterhUbCAvailable sinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pZac2.1 SV40-CMV-SaCas9-3xNLS
Plasmid#78601PurposeAAV vector containing SaCas9DepositorInsertSV40-CMV-SaCas9-3xNLS
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterSV40, CMV promotersAvailable sinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Px330-EGFP-DJ1 X1-5DEL gRNA (1)-CRISPR_Cas9
Plasmid#214929Purpose5' gRNA to target Exon 1-5 of DJ-1/PARK7 (dual guide CRISPR)DepositorInsert5' gRNA to target Exon 1-5 of DJ-1 (dual guide approach) (PARK7 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceOct. 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
Px330-mCherry-DJ1 X1-5DEL sgRNA (2)-CRISPR_Cas9
Plasmid#214930Purpose3' gRNA to target Exon 1-5 of DJ-1/PARK7 (dual guide CRISPR)DepositorInsert3' gRNA to target Exon 1-5 of DJ-1 (dual guide approach) (PARK7 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceOct. 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
Px330-mCherry-DJ1 X1-5DEL sgRNA (3)-CRISPR_Cas9
Plasmid#214931Purpose3' gRNA to target Exon 1-5 of DJ-1/PARK7 (dual guide CRISPR) - Secondary targeting for homozygosityDepositorInsert3' gRNA to target Exon 1-5 of DJ-1 (dual guide approach) (PARK7 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceOct. 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-seq2
Plasmid#240865PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-Seq1
Plasmid#240094PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Non-Targeting
Plasmid#241026PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of a non-targeting sgRNA; used as control for SaCas9 based knock-outs in murine astrocytesDepositorInsertU6 driven empty sgRNA
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable sinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty Cassette
Plasmid#113693PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. SapI can be used to clone in gRNAs.DepositorInsertSaCas9 gRNA Cassete
UseAAV and CRISPRAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-3xmScarlet-dCas9
Plasmid#248561PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertdCas9
UseCRISPRTags3xmScarlet and HA, 2xNLSExpressionMammalianMutationD10A, H840APromoterCMV, TetO2Available sinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-nSpCas9-APOBEC3A
Plasmid#209040PurposeLentiviral vector expressing doxycycline-inducible human codon-optimized cytosine base editor where APOBEC3A is fused to the N-terminus of SpCas9(D10A)-sDNA Rad51-2xUGI-6xNLSDepositorInsertAPOBEC3A-nSpCas9
UseCRISPR and LentiviralTagsFLAG-HAExpressionMammalianMutationD10APromoterTight TRE promoterAvailable sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMSCVhyg
Plasmid#134323PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLSExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-CBE6d-IVT
Plasmid#215836PurposeTemplate for in vitro transcription of CBE6d (with SpCas9)DepositorInsertCBE6d-SpCas9-2xUGI
UseIn vitro transcription templateAvailable sinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-P3-evoCjCas9-TadCDd_gRNA
Plasmid#202563PurposeP3-evoCjCas9-TadCDd and hU6-BsmBI-gRNA in AAV2 backbone (ITRs)DepositorInsertevoCjCas9-TadCDd
UseAAVAvailable sinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-AAVS1_sgRNA
Plasmid#183891PurposepX459V2.0-HypaCas9 plasmid with sgRNA targeting the AAVS1 in human cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAAVS1 sgRNA spacer (AAVS1 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_TUBA1B sgRNA / hSpCas9
Plasmid#172834PurposeMammalian expression of a sgRNA targeting the intron 1 of TUBA1B (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting intron 1 of TUBA1B under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR-EF1adCas9VP64_T2A_MS2p65HSF1-IRESneopA
Plasmid#112921PurposeGateway entry vector carrying human EF1a promoter-driven dCas9VP64-T2A-MS2p65HSF1 with Neomycin resistant markerDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEF1a promoter, dCas9VP64, MS2p65HSF1, IRESneo
UseGateway CloningExpressionMammalianAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only