We narrowed to 8,504 results for: aav
-
Plasmid#230005PurposeGal4-dependent expression of secreted BiTEDepositorInsertUAS-anti-CD3/anti-CD19 BiTE
UseAAVExpressionMammalianPromoterUASAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1977 - pAAV-AiE2586m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214601PurposeAiE2586m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST
Plasmid#109048PurposeAnion channelrhodopsin GtACR1 fused to ER export signal and targeted to the neuronal soma and proximal dendrites under the control of internal ribosome entry sequence in a viral vectorDepositorHas ServiceAAV9InserteGtACR1-ST
UseAAVPromoterCAGAvailable SinceJuly 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry-shLacZ-CWB
Plasmid#223660PurposeExpresses hM3D(Gq) and a control shRNA (targetting LacZ) in a Cre-dependent mannerDepositorInserthM3D(Gq)-mCherry and shLacZ
UseAAV and RNAiTagsmCherryExpressionMammalianPromoterhSynAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-Vgf-T2A-mCherry-CW3SL
Plasmid#223661PurposeExpresses VGF and mCherry in a Cre-dependent mannerDepositorInsertVgf-T2A-mCherry
UseAAVExpressionMammalianPromoterhSynAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry-shVgf-CWB
Plasmid#223658PurposeExpresses hM3D(Gq) and a shRNA targetting VGF in a Cre-dependent mannerDepositorInserthM3D(Gq)-mCherry and shVGF
UseAAV and RNAiTagsmCherryExpressionMammalianPromoterhSynAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1347 - pAAV-AiE2E118m-minBGpromoter-SYFP2-WPRE3-bGHpA
Plasmid#208136PurposeDirect-expressing SYFP2 in astrocytes AAV Virus. Alias: AiP1347 - pAAV-AiE2118m-minBG-SYFP2-WPRE-BGHpADepositorInsertSYFP2
UseAAVMutationNAPromoterBeta Globin minimal promoterAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-Kir2.1MUT-P2A-EGFP
Plasmid#176279PurposeViral vector for co-expression of non-functional Kir2.1 and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertKir2.1MUT-P2A-EGFP (Kcnj2 Synthetic, Mouse)
UseAAV and Cre/LoxTagsMycExpressionMammalianMutationGYG to AAA (aa144-146)Promoterhuman Synapsin IAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-ChR2-TdTomato (Cre-OFF)
Plasmid#166610PurposeEncodes Cre-inactivated ChR2-TdTomato under control of the TREDepositorInsertChR2-TdTomato
UseAAVMutationH134RPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
(565) pAAV Alb-AAT KRAB-SadCas9 U6-gSTOP
Plasmid#163030PurposeExpression of CRISPRi with gSTOP gRNADepositorInsertMammalian codon-optimized SadCas9
UseAAVTagsKRAB, SV40 pA, and myc NLSExpressionMammalianPromoterAlb-AATAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-EYFP-WPRE-HGHpA
Plasmid#20296PurposeCre-activated AAV expression of EYFPDepositorInsertEYFP
UseAAVExpressionMammalianAvailable SinceMay 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
AiP981-pAAV-mscRE4-minBGpromoter-EGFP-WPRE-hGHpA
Plasmid#163484PurposeDirect-expressing EGFP AAV Virus. Alias: AiP981 - pAAV-AiE2004m-minBG-EGFP-WPRE-HGHpADepositorInsertEGFP
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eGFP-2A-TetanusToxin (Cre-OFF)
Plasmid#166611PurposeEncodes Cre-inactivated GFP-2A-Tetanus toxin light chain under control of the TREDepositorInsertEGFP-2A-Tetanus Toxin
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV CMV-DIO-(mCherry-U6)-shRNA(anti-Crh)
Plasmid#214732PurposeExpresses shRNA against CRH, marked with mCherry, in infected and cre positive cellsDepositorInsertanti-Crh shRNA / mCherry
UseAAVAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-EGFP
Plasmid#51093PurposeForebrain principal neuron expression of oChIEF kinetic variant E163A/T199C with physically uncoupled EGFP fluorophoreDepositorInsertoChIEF(E163A/T199C)
UseAAVTagsP2A-EGFPExpressionMammalianMutationE163A/T199CPromoterCaMKIIaAvailable SinceMay 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hnEF Coff/Fon hChR2(H134R)-EYFP
Plasmid#55649PurposeCre-off/Flp-on ChR2-EYFP under the short Ef1a promoterDepositorInsertChR2(H134R)-EYFP
UseAAV; Cre off/flp on chr2-eyfpTagsEYFPExpressionMammalianPromoterShort Ef1Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spA
Plasmid#109320PurposePlasmid for AAV SaCas9 Mammalian Expression with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FSF-FLEX-EGFP-WPRE-bGHpA
Plasmid#65455PurposeCan be used to generate AAV virus that will express EGFP from the CAG promoter under intersectional control by Flp and Cre recombinasesDepositorInsertEGFP
UseAAVPromoterCAGAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only