We narrowed to 15,868 results for: nar;
-
Plasmid#163796PurposeExpresses highly specific SlugCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationSlugCas9 (R247A, N415A, T421A, R656A)PromoterAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pIRES-hrGFP II-TET1_CD
Plasmid#83570PurposeExpresses the catalytic domain of TET1 in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseTags3X FLAG tag and hr GFP IIExpressionMammalianMutationTET1 amino acids 1-1417 deletedPromoterCMVAvailable sinceAug. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMA7-SacB
Plasmid#79968PurposeTM-MAGE strainDepositorInsertsLambda Red recombinase beta subunit
DNA adenine methylase
Levansucrase
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterpBADAvailable sinceSept. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRY-Gal∆DD (B1013)
Plasmid#92035PurposeExpresses CRY2 (full-length, with endogenous NLS) fused to Gal4 (aa1-65 of Gal4BD), downstream of mCherry-IRESDepositorInsertCRY2 (CRY2 Mustard Weed)
UseTagsExpressionMammalianMutationFusion of plant CRY2 to Gal4 binding domain (AA1-…PromoterAvailable sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV N-SpyCas9-Intein, U6-gRNA scaffold (F+E)
Plasmid#120293PurposeAAV Vector for expression of N-terminal SpyCas9 fragment with Intein and a U6-driven F+E gRNA scaffoldDepositorInsertN-terminal fragment of SpyCas9
UseAAV and CRISPRTagsSV40-NLS and split-inteinExpressionMammalianMutationPromoterAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-ABE8e
Plasmid#206882PurposeExpresses FLAG-tagged ABE8e fused to Gag through a linker sequenceDepositorInsertABE8e
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterCMVAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmaxRH
Plasmid#206884PurposeExpresses FLAG-tagged PEmax (lacking the RNAseH domain) fused to Gag through a linker sequenceDepositorInsertPEMax Delta RNAseH
UseTagsFLAGExpressionMutationPromoterCMVAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-2C-NLS in pCSDest
Plasmid#126638PurposeExpresses LbCas12a-2C-NLS in mammalian cellDepositorInsertLbCas12a-2C-NLS
UseCRISPRTags3xHuman influenza hemagglutinin (HA)-TagExpressionMammalianMutationPromoterCMV IE94 promoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-GST-eIF4E K119A
Plasmid#112818PurposeExpresses N-terminally GST-tagged mouse Eif4e K119A in bacterial cellsDepositorInsertEif4e (Eif4e Mouse)
UseTagsGSTExpressionBacterialMutationK119 mutated to A, increasing affinity for cap st…PromoterT7Available sinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
CIB-VP64 (B1016)
Plasmid#92037PurposeExpresses CIB1 (Full-length, with endogenous NLS) fused to VP64 activation domain (4xVP16 inserts)DepositorInsertCIB1-VP64 (CIB1 Mustard Weed)
UseTagsFusion of plant CIB1 with VP64 activation domain.…ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC19_Ntag_BbsI-Mammalian
Plasmid#186674PurposeN-terminal tag cassette with BbsI restriction sites for CRISPR donor plasmid.DepositorInsertMammalian N-terminal Tag
UseTags3xFlag-3xHAExpressionMammalianMutationPromoterAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
A3Ai-Cas9n-UGI-NLS
Plasmid#109425PurposeExpresses human APOBEC3A containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3A (APOBEC3A Human)
UseCRISPRTagsExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
LLP773_pLenti-6xHRBKET-sgRNA
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralTagsExpressionMutationPromoterpCMV and U6Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV_T7-PE2-Nuclease
Plasmid#171997PurposeSequence provided for PE-Nuclease mRNA transcription, suitable for microinjectionDepositorInsertCMV_T7-Cas9-RT
UseTagsExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-mTET1_CD
Plasmid#83571PurposeExpresses a mutant catalytic domain of TET1 in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseTags3X FLAG tag and hr GFP IIExpressionMammalianMutationTET1 amino acids 1-1417 deleted, catalytic domain…PromoterCMVAvailable sinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS300E/S302D
Plasmid#62531PurposeSerine 300 of Drosha is mutated to glutamic acid and serine 302 is mutated to aspartic acidDepositorInserthuman Drosha with serine 300 changed to glutamic acid and serine 302 changed to aspartic acid (DROSHA Human)
UseTagsGFPExpressionMammalianMutationchanged serine 300 to glutamic acid and serine 3…PromoterAvailable sinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMS-dsRed2-WT LMNA-GFP minigene
Plasmid#128230PurposeLamin A splicing reporterDepositorInsertlamin A (LMNA Human)
UseTagsGFP and SV40-driven dsRed2 to identify transfecte…ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT POLI
Plasmid#131228PurposeExpression of WT DNA polymerase iota with an N-terminal FLAG tag in mammalian cellsDepositorInsertDNA polymerase iota (POLI Human)
UseTagsFLAGExpressionMammalianMutationCoding sequence has been codon optimised for expr…PromoterCMV enhancer + CMV promoterAvailable sinceDec. 27, 2019AvailabilityAcademic Institutions and Nonprofits only