We narrowed to 16,550 results for: OMP;
-
Plasmid#61777PurposeLuciferase reporter containing the 3'UTR of mouse Smad5DepositorInsertmouse Smad5 3'UTR
UseLuciferaseAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGF008
Plasmid#48848PurposeProvides a BASTA resistance cassette as GreenGate module.DepositorInsertpNOS::BastaR::tNOS
UseGolden gate compatible cloning vectorMutationchi sequence in BastaR removed by silent substitu…Available SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK SIRT4 3'UTR
Plasmid#19860DepositorInsertSIRT4 3' UTR (SIRT4 Human)
ExpressionMammalianAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMP117
Plasmid#207920PurposeGreenBraid destination vector pGBZ2 - PaqCI - Eco31I - spisPink- Eco31I - PaqCIDepositorTypeEmpty backboneExpressionPlantAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
PAmCherry1-C1-LACT-C2
Plasmid#202682PurposePhotoactivatable lipid biosensorDepositorInsertPAmCherry1: Bos taurus MFGE8 (274-431) (MFGE8 Bovine)
ExpressionMammalianAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEXSY-hyg2.1_LtIFT43_Flag
Plasmid#194433PurposeExpression of a flag tagged version of L. tarentolae intraflagellar transport protein-43 (IFT43) in Leishmania tarentolaeDepositorInsertIntraflagellar transport complex subunit 43
UseLeishmania tarentolae expressionTags3X Flag and LinkerPromoterL.donovani promoter elementsAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 gfaABC1D-Ezr-eGFP
Plasmid#176856PurposeExpresses Ezrin fused with eGFP at the C-terminus in astrocytesDepositorInsertEzr-GFP
UseAAVTagsGFPExpressionBacterialPromotergfaABC1DAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MS2-HA-HshnRNPH1_Z
Plasmid#148120PurposeMammalian Expression of HshnRNPH1DepositorInsertHshnRNPH1 (HNRNPH1 Human)
ExpressionMammalianMutationone silent mutation compared to the sequence give…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28-T7-NlaCas3-NLS-6xHis
Plasmid#180214PurposeExpressing Neisseria lactamica Type I-C Cas3 with NLS and His tag on the C terminus for protein purification in E.ColiDepositorInsertNlaCas3c
Tags6xHis and NLSExpressionBacterialPromoterT7Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-29b(+)-mSandy2
Plasmid#177760PurposeExpresses mSandy2 using the T7 PromoterDepositorInsertmSandy2
Tags6xHis tagExpressionBacterialPromoterT7 PromoterAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-cDAXX
Plasmid#169729PurposeBacterial expression of N-terminally 6His tagged cDAXXDepositorAvailable SinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSW149
Plasmid#122248PurposepTYB2 containing TIF4631 gene, expresses yeast eIF4G1 as an intein-chitin-binding domain fusion for purification of untagged full-length protein, with or without a fluorescent label on the C-terminus.DepositorInsertTIF4631 (TIF4631 Budding Yeast)
TagsIntein-Chitin-binding domainExpressionBacterialPromoterT7Available SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR358.4
Plasmid#125114PurposeExpression of narL(1-159aa)-liaR(154-211aa) chimera under PLtetO-1, output Promoter PliaI121DepositorInsertsnarL(REC)-liaR(DBD)159
sfgfp
tetR
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKD279
Plasmid#125099PurposeExpression of SO_4388(1-130aa)-psdR(134-237aa), ompR137 chimera under PLtetO-1, output Promoter PpsdA110DepositorInsertsSO_4388(REC)-psdR(DBD)137
sfgfp
tetR
UseSynthetic BiologyExpressionBacterialAvailable SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOPS0254
Plasmid#115506PurposeReporter plasmid suitable for experiments in environments where there is no antibiotic selection present. Symbiosis-induced nifH promoter from Rhizobium leguminosarum biovar vicia 3841 (Rlv3841pNifH) expressing celBDepositorInsertRlv3841pNifH pOGG082, celB pOGG050, T-pharma pOGG003 assembled in pOGG026
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-HA/Bmal L95E
Plasmid#47344PurposePcHA-Bmal backbone used for the above mutation. Ref.Genes & Dev 17:1921-1932 2003DepositorAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV-P3-evoCjCas9-eAID_gRNA
Plasmid#202562PurposeP3-evoCjCas9-eAID and hU6-BsmBI-gRNA in AAV2 backbone (ITRs)DepositorInsertevoCjCas9-eAID
UseAAVAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAM9
Plasmid#78560PurposepBAD30::ompU V. cholerae 395 Induce with 0.2% arabinose. Expression system: V. cholerae 395 outer membrane protein OmpU.DepositorInsertompU
ExpressionBacterialPromoteraraBAD promoterAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOmniBac zz TEV YBBR POT1
Plasmid#185444PurposeExpresses human POT1 with a zz affinity tag, YBBR labeling site, and TEV cleavage site in insect cellsDepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only