We narrowed to 14,273 results for: cas9
-
Plasmid#198325PurposeExpresses CENPTΔC-dCas9-3xGFP protein in mammalian cells. When coupled with a guide RNA against a high repeat target locus, this can be applied to seed ectopic kinetochores at the target locusDepositorInsertCENPTΔC (CENPT Human)
UseLentiviralTagsEGFP x 3 and dCas9ExpressionMammalianMutationtruncation - encodes only amino acids 1-375PromoterCMV-TetOAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-RHOA_sgRNA
Plasmid#183878PurposepX459V2.0-HypaCas9 plasmid with RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_VCL sgRNA / hSpCas9
Plasmid#172837PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of VCL (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of VCL under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dpcoCas9-SunTag
Plasmid#158410PurposeCRISPR-dpcoCas9 fused with SunTag recruiting VP64 activators for transcriptional activationDepositorInsertdpcoCas9-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-VP64-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dpcoCas9-EV2.1
Plasmid#158411PurposeCRISPR-dpcoCas9 fused with EDLL activator for transcriptional activationDepositorInsertdpcoCas9-EDLL-T2A-MS2-VPR(VP64-p65-Rta)-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_eA3A T31A-dCas9
Plasmid#163537PurposeMammalian CG-to-GC base editingDepositorInserteA3A T31A-dCas9
UseCRISPRExpressionMammalianMutationdCas9 (D10A, H840A)eA3A T31AAvailable SinceDec. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-eCas9-sgMIB1
Plasmid#140239PurposeLentiviral vector expressing high-specificity eSpCas9(1.1) and a gRNA targeting human MIB1DepositorInsertsgRNA targeting human MIB1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB-R1R2_EF1ap300dCas9VP64_T2A_MS2p65HSF1-IRESbsdpA
Plasmid#113343PurposeExpresses p300-dCas9-VP64 and MS2-p65-HSF1 fusion proteinsDepositorInsertp300core-dCas9-VP64-T2A-MS2-p65-HSF1
UsePiggybacAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pST1374-dCas9-GCN4
Plasmid#113026PurposeExpresses dCas9-GCN4 in mammalian cellsDepositorInsertdCas9-GCN4 (GCN4 S. pyogenes, Budding Yeast)
ExpressionMammalianMutationD10A, H840A, N863APromoterCMVAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-SpCas9-HF4
Plasmid#108295PurposepX459 V2.0 (Plasmid #62988) with the Y450A, N497A, R661A, Q695A, and Q926A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC148-pCR8-dCas9VP96
Plasmid#48220PurposedCas9VP96 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expressionDepositorInsertdCas9(D10A;H840A) fusion with VP96 activation domain
UseCRISPR and Gateway CloningTagsHA Tag and VP96MutationD10A;H840AAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pVEGFR2_TEV(N)_NES_TCS(Q'L)_HA-dCas9(N)_P2A_Puro-WPRE
Plasmid#101104PurposeEncodes dCas9(N) fused to VEGFR2DepositorInsertVEGFR2-dCas9(N)
UseCRISPR and Synthetic BiologyTagsHAExpressionMammalianAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR ZFAND3-guide4
Plasmid#125459PurposeCRISPR-mediated repression of ZFAND3. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR ZFAND3-guide3
Plasmid#125458PurposeCRISPR-mediated repression of ZFAND3. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR ZFAND3-guide2
Plasmid#125457PurposeCRISPR-mediated repression of ZFAND3. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR ZFAND3-guide1
Plasmid#125456PurposeCRISPR-mediated repression of ZFAND3. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRExpressionMammalianPromoterU6 and short human rhodopsin promoterAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-P2A-EGFP
Plasmid#188898PurposeHuman lentiviral vector for expression of dCas9 with a C-terminal HA-2xNLS and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertdCas9
UseLentiviralTagsHA-2xNLS and P2A-GFPPromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only