We narrowed to 7,086 results for: org
-
Plasmid#234989PurposeFor production of Extracellular Vesicles (EVs), with the receptor Smoothened (Smo), Twin-Strep-tag (TST), and an HA tag at its N-terminus on their surfaceDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pX330-TP53-2
Plasmid#121918PurposeEncodes sgRNA targeting exon 9 of TP53DepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBFC0996
Plasmid#186695PurposeVcDART under control of Lac promoter, Vc_2xBsaI_NT gRNA, 2xLguI cargo stuffer, with ET-Seq (AsiSI+SbfI) restriction sites flanking Tn7 Right EndDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
crRNA
Tn7 transposon
2xLguI Cargo Stuffer
SbfI+AsiSI dual restriction site for donor plasmid removal during ET-Seq
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-PE2-IRES-ZeoR
Plasmid#207352PurposeLentiviral transfer plasmid containing CMV-driven expression cassette encoding PE2 enzyme for prime editing.DepositorInsertPrime editor 2 (PE2) enzyme
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
iGFP-beta-actin
Plasmid#231553PurposeMammalian expression of human beta actin fused intramolecularly to monomeric superfolder GFPDepositorAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-Mito-DsRed1
Plasmid#87379PurposeRetroviral transfection of cells to express DsRed1 (Ex555, Em585) localising to the mitochondrial matrix via the transit peptide from human TXN2 (Thioredoxin).DepositorInsertTXN2 mitochondrial transit peptide (TXN2 Human)
UseRetroviralTagsDsRed1ExpressionMammalianMutationFirst 60 aa onlyPromoterRetroviral 5' LTR promoterAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLEX-PGK-ANXA11-mCerulean
Plasmid#164214PurposepLEX lentivirus backbone expresses mCerulean tagged ANXA11 under PGK promoterDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-Lbr-V5-mCherry
Plasmid#235094PurposeLbr mCherry fusion protein without MCP domainDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN5 + PGK-puro
Plasmid#167817PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
Tagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
iGFP-gamma-actin
Plasmid#231554PurposeMammalian expression of human gamma actin fused intramolecularly to monomeric superfolder GFPDepositorAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX-PGK-LAMP1-EYFP
Plasmid#164215PurposepLEX lentivirus backbone expresses EYFP tagged LAMP1 under PGK promoterDepositorAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-EGFP-PA-BAX(ER)
Plasmid#228941PurposeStable expression of EGFP-LOV2(N538E)-BAX-Cyb5a in mammalian cells. Photoactivatable BAX localizes on ER and induces ER rupture upon blue light stimulation.DepositorUseRetroviralTagsEGFPExpressionMammalianMutationN-terminus and C-terminus are deleted. BAX(3-171)…Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-RNF2-tevopreQ1-epegRNA+5G>T_EF1a-puroR
Plasmid#207355PurposeLentiviral transfer plasmid encoding hU6-driven expression of a RNF2 engineered prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertRNF2 + 5G>T tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4-ires-blast
Plasmid#167829PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN4
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-KozATG-dL5-2XG4S-actin
Plasmid#73262PurposeExpresses dL5(E52D)-actin fusion within mammalian cells. (MBIC5, dL5**, FAP)DepositorInsertKozATG-dL5-2XG4S-actin (ACTB Synthetic, Human)
TagsThe FAP and actin are fused with 2 copies of a G4…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-HOPX
Plasmid#192923PurposeBarcoded piggybac transposon vector with Dox-inducible expression of HOPXDepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2-sfCherry2_SEPT6
Plasmid#180313Purposebacterial co-expression of human SEPT2 fused to superfolder Cherry2 and of human SEPT6DepositorTagsHis6-TEV and sfCherry2ExpressionBacterialAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB CAG SMARCA4 T910M-Venus
Plasmid#153951PurposepiggyBac transposon vector with CAG promoter expressing SMARCA4 (T910M mutant)-Venus fusion proteinDepositorAvailable SinceAug. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN5 + PGK-blast
Plasmid#167818PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
Tagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only