We narrowed to 5,260 results for: PID
-
Plasmid#203502PurposeExpresses HCoV-NL63 PLP2 from a GAL promoter with a URA3 markerDepositorInsertHCoV-NL63 PLP2 (ORF1ab )
UseTagsExpressionYeastMutationPromoterGAL1Available sinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-ZIKV_NS2B-GS-NS3
Plasmid#203477PurposeExpresses ZIKV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorInsertZIKV NS2B-GS-NS3 (POLY )
UseTagsExpressionYeastMutationPromoterGAL10Available sinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-HCoV-OC43_3CL
Plasmid#203503PurposeExpresses HCoV-OC43 3CL protease from a GAL promoter with a URA3 markerDepositorInsertHCoV-OC43 3CL protease (ORF1ab )
UseTagsExpressionYeastMutationPromoterGAL1Available sinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCavin1a in pT3TS-Dest
Plasmid#194294PurposeIn vitro transcription of mKate2 tagged zebrafish cavin1a from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone LAIDepositorInsertcavin1a (cavin1a Zebrafish)
UseIn vitro transcription of mrnaTagsExpressionMutationPromoterAvailable sinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-HsNRF2 (NFE2L2)
Plasmid#194302PurposeMultisite gateway entry clone for expression of human NRF2 (NFE2L2) with fusion tag at the N-terminus. Parton lab clone KRSDepositorInsertNFE2L2 (NFE2L2 Human)
UseMultisite gateway entry vectorTagsExpressionMutationPromoterAvailable sinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET15b MOSPD2 [315-445]
Plasmid#186474PurposeExpression of human MOSPD2 (MSP domain from residue 315 to 445), fused to a cleavable 6HIS tag, in bacteriaDepositorInsertMOSPD2 motile sperm domain containing 2 (MOSPD2 Human)
UseTags6HISExpressionBacterialMutationMSP domain [315-445]PromoterAvailable sinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-His6-K2P4.1A-mCherry-StreptagII
Plasmid#158743PurposeExpresses K2P4.1 isoform A with TEV protease cleavable N- and C-terminal affinity tags.DepositorInsertK2P4.1-A (KCNK4 Human)
UseTagsHis6 and mCherry with Streptag IIExpressionYeastMutationResidues 1-264 with N-linked glycosylation sites …PromoterAOX1Available sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_Luciferase_sgRNA
Plasmid#155109Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting LuciferaseDepositorInsertLuciferase_sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_Luciferase_sgRNA
Plasmid#155094Purposelentiviral plasmid expressing Cas9 and gRNA targeting LuciferaseDepositorInsertLuciferase_sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBOB-N-3HA-GK_v2
Plasmid#134277PurposeLentivector encoding 3XHA-tagged GK (isoform 2)DepositorInsertGk (Gk Mouse)
UseLentiviralTags3X HAExpressionMammalianMutation553 amino acids, isoform 2PromoterCMVAvailable sinceMay 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMDC43-FIT2-N[80]A
Plasmid#96995PurposeExpress GFP-tagged mutated mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
UseTagsGFPExpressionPlantMutationAmino acid residue 80 was mutated (N[80]A). Mutat…Promoter35SAvailable sinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1D4-mCherry
Plasmid#73423PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1D4.DepositorInsertPromoter 1D4 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterP1D4 (orthogonal T7-lac variant)Available sinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-4A6-mCherry
Plasmid#73424PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 4A6.DepositorInsertPromoter 4A6 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterP4A6 (orthogonal T7-lac variant)Available sinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1E4-mCherry
Plasmid#73426PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1E4.DepositorInsertPromoter 1E4 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterP1E4 (orthogonal T7-lac variant)Available sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1B6-mCherry
Plasmid#73420PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1B6.DepositorInsertPromoter 1B6 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterP1B6 (orthogonal T7-lac variant)Available sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3H5-mCherry
Plasmid#73419PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3H5.DepositorInsertPromoter 3H5 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterP3H5 (orthogonal T7-lac variant)Available sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pde3b_L (OZ591)
Plasmid#35231DepositorInsertZinc finger array targeting pde3b (pde3b Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceMarch 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pde3b_R (OZ592)
Plasmid#35232DepositorInsertZinc finger array targeting pde3b (pde3b Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
LOC566040_ R (OZ588)
Plasmid#35228DepositorInsertZinc finger array targeting LOC566040 (LOC566040 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only