We narrowed to 2,246 results for: Xpa
-
Plasmid#122954PurposeLentiviral expression of NOTCH2NLB full length under CAG promoter with EGFP expressionDepositorAvailable sinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pCMV-MtAcKRS (human-opti)
Plasmid#164195PurposeTo express a Methanosarcina thermophila derived AcKRS in mammalian cells for genetic code expansionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMtAcKRS-478(human-opti)
UseSynthetic BiologyExpressionMammalianMutationD76G; L325M; L329I; Y330F; L333A; C372FPromoterCMVAvailable sinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR-RUNX2-IDR-mCherry-CRY2-NLS
Plasmid#145267PurposeMammalian Expression of Nuclear Opto RUNX2 IDR with SV40 NLSDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRUNX2wt-IDR (RUNX2 Human)
ExpressionMammalianAvailable sinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBT271.359
Plasmid#127845Purposeclone A3A CBEs by SapI Golden GateDepositorInsertA3A
Available sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV uN2C GFP (Ctl)
Plasmid#224355PurposeExpress GFP tagged upsteram ORF of NOTCH2NLC with a control size (12x) of GGC repeatsDepositorInsertuN2C
UseAAVTagseGFPExpressionMammalianMutationCodon-optimized for expression in human, so no pu…PromoterCMV + chimeric intyron (CAG)Available sinceOct. 7, 2024AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pEC2935 (p7INT-P23_mNeongreen~ssrA (LDD variant))
Plasmid#218508Purposeintegrative plasmid enabling constitutive expression of a destabilized mNeongreen reporter in Streptococcus pyogenes, targets the attP site of phage T12 in several S. pyogenes strains via an integraseDepositorInsertmNeongreen
Tagsmodified ssrA degradation tagExpressionBacterialMutationdeletion of MCS containing Plac_lacZa, introducti…PromoterP23Available sinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pH1v1
Plasmid#60244PurposegRNA expression by the H1 promoterDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterH1 promoterAvailable sinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCfB2194
Plasmid#67545PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked hphMX marker, integration into S. cerevisiae X-4 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable sinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2195
Plasmid#67548PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked hphMX marker, integration into S. cerevisiae XI-3 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable sinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD085
Plasmid#212922PurposeEncodes the HA-tagged 649 Stalk yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsert649 Stalk
ExpressionBacterialAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGWB401NL3F10H
Plasmid#141285PurposeNo promoter, C-terminal NLUC:3xFlag:10xHis tag, attR1-Cmr-ccdB-attR2-NLUC:3xFlag:3xHis-TNOS (modified pGWB401, pPZP backbone, SpcR for bacteria, KmR for plant)DepositorTypeEmpty backboneUseGateway Cloning and LuciferaseTagsFLAG (x3), HIS (x10), and NLUCExpressionPlantAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHJ2: LexA DBD
Plasmid#108240PurposeLexA DNA binding domainDepositorInsertLexA DNA binding domain (1-87)
UseSynthetic BiologyPromoterpLacO1Available sinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEvol-MmKlacRS1
Plasmid#232157PurposeSite-specific incorporation of L-lactyl-lysine into target proteins in E. coli cells.DepositorInsertKlacRS1
UseSynthetic BiologyExpressionBacterialAvailable sinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEC3105 (pSpy1C-PxylS2_ffluc)
Plasmid#218512Purposereplicative E. coli-S. pyogenes shuttle plasmid, constitutive expression of firefly luciferase reporterDepositorInsertffluc
UseLuciferaseMutationdeletion of Plac_mrfp cassettePromoterPxylS2Available sinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJW1839
Plasmid#154325PurposesgRNA Destination Vector for SapTrapDepositorInsertSapTrap sgRNA (F+E) vector, R07E5.16 U6 promoter
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable sinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_BtKY72-Spike
Plasmid#190084Purposeexpress BtKY72 spikeDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBtKY72-CoV S bat
TagsRhodopsin C9ExpressionMammalianPromoterCMVAvailable sinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBEAST-J23101-sfGFP
Plasmid#116917PurposeStrong constitutive expression of super-folder GFP for cell-free expressionDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisPromoterJ23101Available sinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNEU-KlacRS
Plasmid#232155PurposeSite-specific incorporation of L-lactyl-lysine into target proteins in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertKlacRS1
UseSynthetic BiologyExpressionMammalianAvailable sinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only