We narrowed to 51,260 results for: des.1
-
Antibody#180111-rAbPurposeAnti-Navbeta4 Na+ channel (Rat) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunocytochemistry and ImmunohistochemistryReactivityMouse and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceMarch 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA (AAV8)
Viral Prep#61592-AAV8PurposeReady-to-use AAV8 particles produced from pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA (#61592). In addition to the viral particles, you will also receive purified pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA plasmid DNA. CMV-driven expression of SaCas9. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.cTNT.iCre (AAV9)
Viral Prep#69916-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.cTNT.iCre (#69916). In addition to the viral particles, you will also receive purified pAAV.cTNT.iCre plasmid DNA. cTnT driven in vivo expression of Cre and tdTomato (separated by IRES sequence). These AAV preparations are suitable purity for injection into animals.DepositorPromoterChicken cardiac troponin TTagstdTomatoAvailable SinceJuly 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA (AAV6)
Viral Prep#61592-AAV6PurposeReady-to-use AAV6 particles produced from pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA (#61592). In addition to the viral particles, you will also receive purified pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA plasmid DNA. CMV-driven expression of SaCas9. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-hChR2-H134R-tdTomato (AAV Retrograde)
Viral Prep#28017-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-CAG-hChR2-H134R-tdTomato (#28017). In addition to the viral particles, you will also receive purified AAV-CAG-hChR2-H134R-tdTomato plasmid DNA. Humanized channelrhodopsin H134R mutant fused to tdTomato, under the control of the CAG promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomatoAvailable SinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO eNpHR 3.0-EYFP (AAV Retrograde)
Viral Prep#26966-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-Ef1a-DIO eNpHR 3.0-EYFP (#26966). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO eNpHR 3.0-EYFP plasmid DNA. EF1a-driven, cre-dependent eNpHR 3.0-EYFP for optogenetic inhibition. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Antibody#241893-rAbPurposeAnti-Netrin 1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse Netrin 1. Does not cross-react with other netrins.DepositorArticleRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceDec. 17, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#241894-rAbPurposeAnti-Netrin 1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse Netrin 1. Does not cross-react with other netrins.DepositorArticleRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceDec. 17, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#241895-rAbPurposeAnti-Netrin 1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse Netrin 1. Does not cross-react with other netrins.DepositorArticleRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceDec. 17, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pAAV_hSyn1_nLightG (AAV9)
Viral Prep#187179-AAV9PurposeReady-to-use AAV9 particles produced from pAAV_hSyn1_nLightG (#187179). In addition to the viral particles, you will also receive purified pAAV_hSyn1_nLightG plasmid DNA. Synapsin-driven expression of norepinephrine sensor nLightG. These AAV preparations are suitable purity for injection into animals.DepositorPromoterhuman Synapsin-1Available SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn1_nLightR (AAV9)
Viral Prep#187180-AAV9PurposeReady-to-use AAV9 particles produced from pAAV_hSyn1_nLightR (#187180). In addition to the viral particles, you will also receive purified pAAV_hSyn1_nLightR plasmid DNA. Syn-driven expression of red norepinephrine sensor nLightR. These AAV preparations are suitable purity for injection into animals.DepositorPromoterhuman Synapsin-1Available SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV1)
Viral Prep#87306-AAV1PurposeReady-to-use AAV1 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV9)
Viral Prep#87306-AAV9PurposeReady-to-use AAV9 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV2)
Viral Prep#87306-AAV2PurposeReady-to-use AAV2 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV5)
Viral Prep#87306-AAV5PurposeReady-to-use AAV5 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A12.T)
Viral Prep#157970-AAV.A12.TPurposeReady-to-use AAV44.9(E531D) in PBS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A01.T)
Viral Prep#157970-AAV.A01.TPurposeReady-to-use AAV2 in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A09.T)
Viral Prep#157970-AAV.A09.TPurposeReady-to-use AAV6 in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A11.T)
Viral Prep#157970-AAV.A11.TPurposeReady-to-use AAV44.9 in PBS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only