We narrowed to 875 results for: Anti-CRISPR
-
Plasmid#109431PurposeMLM3636 backbone containing a gRNA that guides Cas9 to codon 59 of mCherry in the ACE reporterDepositorInsertmCherry codon 59 gRNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-scFv-p65-HSF1-Blast
Plasmid#192652Purpose3rd generation lenti vector encoding scFV-p65-HSF1 with 2A Blast resistance markerDepositorInsertscFv-p65-HSF1
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dzCas9-Act3.0
Plasmid#158414PurposeCRISPR-Act3.0 system containing dzCas9-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdzCas9-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dpcoCas9-Act3.0
Plasmid#158408PurposeCRISPR-Act3.0 system containing dpcoCas9-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdpcoCas9-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dSpRY-Act3.0
Plasmid#158416PurposeCRISPR-Act3.0 system containing dSpRYCas9-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdSpRY-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
INT_SS9sp
Plasmid#212145PurposeEffector plasmid for for operon integration into the genome (Safe Site 9) using CRISPR-Cas12a. Plasmid can be removed by incubating cells at 37 C.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, VchTnsA, VchTnsB, VchTnsC
ExpressionBacterialPromoterpJ23119Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
PECAM1-3'gRNA
Plasmid#235606PurposegRNA targeting PECAM1 3' terminal for CRISPR-Cas9-mediated knock-inDepositorAvailable SinceJune 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mA-srt-his
Plasmid#124806PurposeHDR template to knock-in mouse IgA Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgA producing cell lines.DepositorInsertMurine IgA
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG2a-srt-his
Plasmid#124803PurposeHDR template to knock-in mouse IgG2a Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG2a producing cell lines.DepositorInsertMurine IgG2a
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG2b-srt-his
Plasmid#124804PurposeHDR template to knock-in mouse IgG2b Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG2b producing cell lines.DepositorInsertMurine IgG2b
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG1-srt-his
Plasmid#124802PurposeHDR template to knock-in mouse IgG1 Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG1 producing cell lines.DepositorInsertMurine IgG1
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianPromoter-Available SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG3-srt-his
Plasmid#124805PurposeHDR template to knock-in mouse IgG3 Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG3 producing cell lines.DepositorInsertMurine IgG3
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPlatTET-gRNA2
Plasmid#82559PurposeAll in one vector which contains Cas9 peptide array (linker length: 22aa), antibody-sfGFP-TET1CD, and gRNA expression system.DepositorInsertdCas9-5xPlat2AflD-P2A-scFvGCN4sfGFPTET1CD
ExpressionMammalianAvailable SinceSept. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR_502_sgCD45
Plasmid#158705PurposeCD45 CRISPRa controlDepositorInsertCD45 (PTPRC Human)
UseLentiviralAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGG438
Plasmid#165486PurposeVector for expression of the SpCas9 VRKG variant in human cells: CMV-T7-humanVRKG(SpCas9, D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFLAGDepositorInsertMammalian codon-optimized Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFlag
UseCRISPRTags3x FLAG and SV40 NLSExpressionMammalianMutationD1135V, S1136R, D1332K, and R1333G mutations in S…PromoterCMV and T7Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dzCas9-NG-Act3.0
Plasmid#158415PurposeCRISPR-Act3.0 system containing dzCas9-NG-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdzCas9-NG-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dAaCas12b-Act3.0
Plasmid#158413PurposeCRISPR-Act3.0 system containing dAaCas12b-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdAaCas12b-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only