We narrowed to 16,918 results for: Emb;
-
Plasmid#193051PurposeExpression of artificial transmembrane protein tagged with mEGFP and MBP at the plasma membrane. Control construct for single molecule co-localization and co-tracking microscopy.DepositorInsertALA7-TMD
UseTagsIg k-chain leader sequence, MBP, and mEGFPExpressionMammalianMutationPromoterCMVAvailable sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-1A32
Plasmid#191241PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-1A32 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), HLA-A (HLAA) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
UseTagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable sinceFeb. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-1A31
Plasmid#191242PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-1A31 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), HLA-A (HLAA) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
UseTagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable sinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-CP8B1
Plasmid#191240PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-CP8B1 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), CYP8B1 (CYP12) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
UseTagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_dHMGA_mKate2_CLEAVAGE
Plasmid#167337PurposeExpresses mKate2 fused to TFAM dHMGA mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable sinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_HMGB_ctail_mKate2_CLEAVAGE
Plasmid#167338PurposeExpresses mKate2 fused to TFAM HMGB+C-tail mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable sinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHis-TEV-mCherry-LC3B-Gly (Microtubule-associated proteins 1A/1B light chain 3B)
Plasmid#169168PurposeConjugatable form of LC3B lacking 5 C-terminal amino acids (MKLSV), with C-terminal Glycine120 exposed for lipidation reaction.DepositorInsertMAP1LC3B (MAP1LC3B Human)
UseTags6X Histidine Tag, TEV cleavage site, mCherryExpressionBacterialMutationPromoterT7 lac promoterAvailable sinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAraGFP
Plasmid#39548DepositorInserteGFP
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAraTM
Plasmid#39547DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterTacAvailable sinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
KTD101(DE3)
Bacterial Strain#138651PurposeKTD101(DE3) is a trigger factor deficient strain, which may increase protein secretion from Escherichia coli, and is compatible with expression from the T7 promoterDepositorBacterial ResistanceNoneSpeciesEscherichia coliAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a AHU
Plasmid#26640DepositorInsertAHU
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAraTM-2BTMCYwt
Plasmid#39549DepositorInsertIntegrin alpha2B TM-CYTO
UseTagsExpressionBacterialMutationPromoterTacAvailable sinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAraTM-2BTMCYL980A
Plasmid#39550DepositorInsertIntegrin alpha2B L980A TM-CYTO
UseTagsExpressionBacterialMutationPromoterTacAvailable sinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET50delCT_Vipp1_dL10Ala
Plasmid#223817PurposeBacterial expression of Vipp1_dL10Ala with C-terminal 6x His-Tag and 3C cleavage siteDepositorInsertVipp1
UseTags6xHisExpressionBacterialMutationreplacement of 10 aa in Hinge 2 with AlaPromoterAvailable sinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOmpF
Plasmid#42606DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterT7Available sinceFeb. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAraGFPCDF
Plasmid#47516PurposeContains PBAD::GFP reporter, used for heterodimer competition assayDepositorInsertGFP
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
POC1355
Plasmid#221572PurposeAssembly vector designed to be methylated by the M.Osp807II BsaI-associated switch methylase and for the assembly of inserts 1, 2, 3 and 4 from POC1343, POC1344, POC1345 and POC1346; respectivelyDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only