We narrowed to 22,058 results for: AGA
-
Plasmid#172628PurposeRetroviral vector for the constitutive, near-physiological expression of 2xFLAG-2xSTREP-tagged cyclin D2 and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3-FLAG_FBXL7 (R310H)
Plasmid#171849PurposepcDNA3-FLAG_FBXL7 (R310H)DepositorInsertF-box and leucine rich repeat protein 7 (FBXL7 Human)
TagsFlagExpressionMammalianMutationchanged Arginine 310 to HistidineAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBABE-2xFLAG-2xSTREP-CCND3-Puro
Plasmid#172622PurposeRetroviral vector for the constitutive, near-physiological expression of 2xFLAG-2xSTREP-tagged cyclin D3 and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-2xFLAG-2xSTREP-CCND1(P287S)-IRES-mCherry
Plasmid#172635PurposeLentiviral bicistronic vector for the constitutive co-expression of 2xFLAG-2xSTREP-tagged cyclin D1(P287S) and mCherry in mammalian cellsDepositorInsertCCND1 (CCND1 Human)
UseLentiviralTags2xFLAG-2xSTREPExpressionMammalianMutationPro287SerPromoterCMVAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-2xSTREP-CCND2(T280A)-Puro
Plasmid#172625PurposeRetroviral vector for the constitutive expression of FLAG-2xSTREP-tagged cyclin D2(T280A) and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-2xSTREP-CCND1-Puro
Plasmid#172643PurposeRetroviral vector for the constitutive expression of FLAG-2xSTREP-tagged cyclin D1 and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP
Plasmid#113156PurposeAn AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporterDepositorInsertTwo gRNAs for rat Rosa26
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLCV2-CDK12(hU6-sg2-mU6-sg3)-Blast
Plasmid#208344PurposepLentiCRISPRv2-Blast backbone with two separate sgRNAs against CDK12DepositorArticleAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-EGFP-PA-BAX(ER, G108V)
Plasmid#233344PurposeStable expression of EGFP-LOV2(N538E)-BAX(G108V)-Cyb5a in mammalian cells. The G108V mutation suppresses pore-forming activity of BAX.DepositorUseRetroviralTagsEGFPExpressionMammalianMutationBAX(3-171), N-terminus and C-terminus are deleted…Available SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-EGFP-PA-BAX(lyso, G108V)
Plasmid#233345PurposeStable expression of EGFP-LOV2(G528A, N538E)-BAX-TMEM106B in mammalian cells. The G108V mutation suppresses pore-forming activity of BAX.DepositorUseRetroviralTagsEGFPExpressionMammalianMutationBAX(3-171), N-terminus and C-terminus are deleted…Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-FLEX-CAG_G-PTEN
Plasmid#227438PurposeAn AAV backbone for expression of the G-PTEN sensor under the CAG promoter, in a Cre dependent manner.DepositorInsertG-PTEN sensor (Pten Rat)
UseAAVTagsCD-sREACh and mEGFPExpressionMammalianMutationR14GPromoterpCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 FFSS-BACH1 C122E
Plasmid#232274PurposeExpression of N-terminal tagged 2xFLAG-2xSTREP-BACH1 (H. sapiens) with Cys122 to Glu point mutation in human cell linesDepositorInsertBACH1 (BACH1 Human)
Tags2xFLAG-2xSTREPExpressionMammalianMutationchanged cysteine 122 to glutamic acidPromoterCMVAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRetroQ-GTSE1-acGFP-S91, 262, 454, 724A
Plasmid#224741PurposeRetroviral vector for delivery and expression of acGFP1-tagged GTSE1 protein with S91, 262, 454, 724A mutationDepositorInsertGTSE1 (GTSE1 Human)
UseRetroviralTagsacGFPMutationSerine 91, 262, 454, 724 to AlaninePromoterCMVAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroQ-GTSE1-acGFP-S91, 262, 454, 724D
Plasmid#224742PurposeRetroviral vector for delivery and expression of acGFP1-tagged GTSE1 protein with S91, 262, 454, 724D mutationDepositorInsertGTSE1 (GTSE1 Human)
UseRetroviralTagsacGFPMutationSerine 91, 262, 454, 724 Aspartate; Valine 53 Iso…PromoterCMVAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgMST1/2-1
Plasmid#229429Purposeknockout of MST1 and MST2DepositorUseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN R255E-HA
Plasmid#186894PurposeDoxycycline-dependent expression of human cGAS gene (with R255E mutation) in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with R255E mutation and C-terminal HA tag (Adamts1 Synthetic, Human)
UseRetroviralTagsHAMutationN-terminal truncation, R255EPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-mouse cGASdeltaN-GFP
Plasmid#186878PurposeDoxycycline-dependent expression of mouse cGAS gene in mammalian cells by retroviral transductionDepositorInsertMouse cGAS truncation mutant (148-508 a.a.) with C-terminal GFP fusion (Cgas Mouse, Synthetic)
UseRetroviralTagsGFPMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-FLAG-human cGASdeltaN-GFP
Plasmid#186879PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with N-terminal FLAG and C-terminal GFP fusion (Adamts1 Synthetic, Human)
UseRetroviralTagsFLAG and GFPMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-GFP-human cGASdeltaN
Plasmid#186880PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with N-terminal GFP fusion (Adamts1 Synthetic, Human)
UseRetroviralTagsGFPMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only