We narrowed to 20,020 results for: 110
-
Plasmid#109699PurposeMultisite gateway vector for 3' tagging with rab38aDepositorInsertrab38a (rab38a Zebrafish)
UseZebrafish plasmidsAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-3'UTR
Plasmid#136042PurposeUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-CDS
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC0.040
Plasmid#119584PurposeLevel 0 part. PromoterDepositorInsertJ23110MH
UseSynthetic BiologyAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
IgH intron enhancer
Plasmid#127247PurposeTo maximize gene expression in B cellsDepositorInsertheavy chain enhancer
ExpressionMammalianAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SCAF8_isoD_CRISPR_resistant
Plasmid#122468PurposepDONR for Gateway cloningDepositorInsertSCAF8 isoform D CRISPR resistant (SCAF8 Human)
UseGateway cloningMutationSynonymous mutations conferring resistance to gRN…Available SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SCAF4_CRISPR resistant
Plasmid#122465PurposepDONR for Gateway cloningDepositorInsertSCAF4 CRISPR resistant (SCAF4 Human)
UseGateway cloningMutationSynonymous mutations conferring resistance to gRN…Available SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-TAK1
Plasmid#117162PurposeTarget site AGCGCCCTTCAATGGAGGAAATDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-IRF5
Plasmid#117157PurposeTarget site TATTTCCCTGTCTCCTTGGCCDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-IRF7
Plasmid#117158PurposeTarget site ATAAGGAAGCACTCGATGTCGDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-STAT2
Plasmid#117161PurposeTarget site TTTAAGTTCCACAGACTTGGADepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
env8 16nt J1/13
Plasmid#99832PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 16nt J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 with 16 nucleotidesAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 19nt J1/13
Plasmid#99834PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 19nt J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 with 19 nucleotidesAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 17nt J1/13
Plasmid#99833PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 17nt J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 with 17 nucleotidesAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 24nt J1/13
Plasmid#99835PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 24nt J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 with 24 nucleotidesAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 7U J1/13
Plasmid#99829PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 7U J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 converted to 7 U'sAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 AC rep J1/13
Plasmid#99830PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 AC rep J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 converted to repeating AC'sAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 25nt J1/13
Plasmid#99836PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 25nt J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 with 25 nucleotidesAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
GAL-MAGE-2-429
Plasmid#89126Purposemammalian expression of full-length human MAGE-A11 with N-terminal GAL4 DNA binding domainDepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
VP-MAGE-2-429
Plasmid#89125Purposemammalian expression of full-length human MAGE-A11 with N-terminal VP16 activation domainDepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only