We narrowed to 5,481 results for: PID
-
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTB*-thymosinB-8His
Plasmid#111146PurposeExpresses human beta-actin fused with thymosin beta and a His tag.DepositorInsertACTB (ACTB Human)
UsePichia pastoris integrationTagsThymosin beta and a His-tagExpressionYeastPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTG1*-thymosinB-8His
Plasmid#111147PurposeExpresses human gamma-actin (codon is optimised for expression in Pichia pastoris) fused with thymosin beta and a His tag.DepositorInsertactin gamma 1 (ACTG1 Human)
UsePichia pastoris integration vectorTagsThymosin beta and a His-tagExpressionYeastMutationcodon-optimised for expression in Pichia pastorisPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-WPRE
Plasmid#179464PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for neuron -specific expression using the promoter hSynDepositorHas ServiceAAV9InsertJEDI-2P
UseAAVExpressionMammalianPromoterhSynAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5_miniTurbo-C12orf49
Plasmid#155111Purposetransfection plasmid for the exogneous expression of N-terminal miniTurbo-tagged C12orf49 for generation of FlpIn cell lines for BioIDDepositorInsertC12orf49 (SPRING1 Human)
TagsminiTurboExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PLIN3
Plasmid#161918PurposeExpresses human PLIN3 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a(+)-HIV RT-6xHis-RBS-prot
Plasmid#159149Purposeexpresses His-tagged HIV reverse transcriptase and untagged HIV proteaseDepositorInsertsHuman immunodeficiency virus 1 (HIV-1) reverse transcriptase
Human immunodeficiency virus 1 (HIV-1) protease
TagsHisExpressionBacterialMutationHIV-1 group M/subtype B – BH10 strainAvailable SinceSept. 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIG-701pUC19-tNGFR-P2A-FOXP3
Plasmid#186114PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NLS-myc-dL5-2xG4S-mCer3
Plasmid#73205PurposeExpresses myc-dL5(E52D)-mCer3 fusion protein in nuclei of mammalian cells. (MBIC5, dL5**, FAP)DepositorInsertNLS-myc-dL5-2XG4S-mCer3 (MYC Synthetic, Human)
TagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PSMD2
Plasmid#161917PurposeExpresses human PSMD2 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorInsert26S proteasome non-ATPase regulatory subunit 2 (PSMD2 Human)
TagsGFP-FLAGExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgRab18.N-Cas9-T2A-mCherry-P2A-Puro
Plasmid#129418PurposeEncoding Cas9 and sgRAB18.N for CRISPR/Cas9 mediated HDR tagging of endogenous human RAB18 N-terminusDepositorInsertSpCas9 and sgRAB18.N (RAB18 Human)
UseCRISPRTagsT2A-mCherry-P2A-PuroExpressionMammalianPromoterhU6Available SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-JEDI-2P-WPRE
Plasmid#179460PurposeDouble floxed genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector under the control of the mammalian promoter (EF1a)DepositorHas ServiceAAV1InsertJEDI-2P
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1m
Plasmid#113049Purposeexpress the genetically-encoded fluorescent dopamine(DA) sensor GRAB_DA1m in neuronsDepositorHas ServiceAAV9InsertGPCR activation based DA sensor GRAB_DA1m (DRD2 Human)
UseAAVPromoterhSynAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-kappa-myc-dL5-2xG4S-TMst
Plasmid#73206PurposeExpresses myc-dL5(E52D)-TM (PDGFR derived) on the surface of mammalian cells, with an Igk-leader. (MBIC5, dL5**, FAP)DepositorInsertkappa-myc-dL5-2XG4S-TM (MYC Human)
TagsThe FAP is fused with 2 copies of a G4S linker an…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h
Plasmid#113050Purposeexpress the genetically-encoded fluorescent dopamine(DA) sensor GRAB_DA1h in neuronsDepositorHas ServiceAAV Retrograde and AAV9InsertGPCR activation based DA sensor GRAB_DA1h (DRD2 Human)
UseAAVPromoterhSynAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pE-N1-RDH11
Plasmid#161916PurposeExpresses untagged human RDH11. Confers G418 resistance.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_6P-D614G
Plasmid#172734PurposeExpression vector for SARS-CoV-2 (HexaPro-D614G) spike used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
Tags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE
Plasmid#179459PurposeDouble floxed soma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector expressed under the mammalian promoter (EF1a)DepositorHas ServiceAAV1InsertJEDI-2P-Kv
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-COXIV-COX8-dL5-2XG4S-mCer3
Plasmid#73208PurposeExpresses dL5(E52D)-mCer3 fusion protein in mitochondria of mammalian cells. (MBIC5, dL5**, FAP)DepositorInsertCOXIV-COX8-dL5-2XG4S-mCer3 (COX8A Synthetic, Human)
TagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only