We narrowed to 14,352 results for: Cas9
-
Plasmid#254794PurposeNegative control for nuclear localization of dCas9-KOX1 expressed via transposase integrationDepositorInsertnoNLS-dCas9-HA-TagBFP-KOX1
UseCRISPRExpressionMammalianMutationcatalytically dead spCas9PromoterCAGAvailable sinceSept. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR
Plasmid#68347PurposeAAV plasmid expressing the FlpO recombinase. with empty gRNADepositorInsertFlPO
UseAAV and CRISPRExpressionMammalianPromoterCAGAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFD152
Plasmid#125546Purposederivative of pFD116 with an optimized RBS for E. coliDepositorInsertoptimized RBS
UseCRISPRPromoteranhydrotetracycline Ptet promoterAvailable sinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pV1093
Plasmid#111428PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at ENO1DepositorPublicationInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable sinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV2)
Viral prep#112677-AAV2PurposeReady-to-use AAV2 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available sinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SaPE2
Plasmid#174817PurposeMammalian expression of SaCas9 prime editor 2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSaPE2
TagsSV40 bpNLSExpressionMammalianMutationDetailed in manuscriptPromoterCMVAvailable sinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJMP1339
Plasmid#119271Purposefor cloning new sgRNAsDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable sinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PRINCE-SpCas9-1
Plasmid#251235PurposePRINCE drug inducible gene editing system based on SpCas9 (Lentiviral-Part II: the SpCas9 expression is under drug-mediated control)DepositorInsertEF1α-SpCas9; 2×NES; 2×ERT2
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
PRINCE-SpCas9-2
Plasmid#250956PurposePRINCE drug inducible gene editing system based on SpCas9 (Lentiviral-Part II: the sgRNA expression is under drug-mediated control)DepositorInsertH1-TetO-SpCas9 sgRNA scaffold; EF1α-optTetR
UseCRISPR and LentiviralExpressionMammalianPromoterH1 promoter; EF1α promoterAvailable sinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
PRINCE-SaCas9-1
Plasmid#250957PurposePRINCE drug inducible gene editing system based on SaCas9 (AAV-Part I : the expression of SaCas9-NES)DepositorInsertEF1α-SaCas9; NES; NpuN;
UseAAV and CRISPRExpressionMammalianPromoterEF1αAvailable sinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
PRINCE-SaCas9-2
Plasmid#250958PurposePRINCE drug inducible gene editing system based on SaCas9 (AAV-Part II : the expression of 2x ERT2 and the sgRNA is under drug-mediated control)DepositorInsertH1-TetO-SaCas9 sgRNA scaffold; EF1α-NpuC; 2×ERT2; opTtetR; GFP
UseAAV and CRISPRExpressionMammalianPromoterH1 promoter; EF1α promoterAvailable sinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
CYLBL_Neo_TREdCas9-KRAB
Plasmid#251231PurposeTRE-dCas9-KRAB knock-in using TALEN at CLYBL locus (derived from Plasmid #220439)DepositorInsertTRE-dCas9 KRAB
UseCRISPR and TALENTagsKRABExpressionMammalianMutationD10A and H840APromoterTREAvailable sinceMarch 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
ABEx2_WT_GFP (ABE8e_L34W_nCas9_WT)
Plasmid#251549PurposeMammalian expression plasmid encoding an nCas9-WT adenine base editor (ABE8e) carrying the L34W mutation in the deaminase domainDepositorInsertecTadA(8e)_L34W-nCas9_WT
UseCRISPRExpressionMammalianMutationABEx2 L34WAvailable sinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
ABEx2_SpRY (ABE8e_L34W_nCas9_SpRY)
Plasmid#251545PurposeMammalian expression plasmid encoding an nCas9-SpRY adenine base editor (ABE8e) carrying the L34W mutation in the deaminase domainDepositorInsertecTadA(8e)_L34W-nCas9_SpRY
UseCRISPRExpressionMammalianMutationABEx2 L34WAvailable sinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
ABEx4_WT_GFP (ABE8e_V28C_M151E_nCas9_WT)
Plasmid#251551PurposeMammalian expression plasmid encoding an nCas9-WT adenine base editor (ABE8e) carrying the V28C and M151E mutations in the deaminase domainDepositorInsertecTadA(8e)_V28C_M151E-nCas9_WT
UseCRISPRExpressionMammalianMutationABEx4 V28C_M151EAvailable sinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
ABEx3_WT_GFP (ABE8e_M151E_nCas9_WT)
Plasmid#251550PurposeMammalian expression plasmid encoding an nCas9-WT adenine base editor (ABE8e) carrying the M151E mutation in the deaminase domainDepositorInsertecTadA(8e)_M151E-nCas9_WT
UseCRISPRExpressionMammalianMutationABEx3 M151EAvailable sinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
M3-dCAS9-DNMT3A
Plasmid#220237PurposeExpresses dCAS9-DNMT3A fusion protein and double marker GFP-T2A-Puro under independent promotersDepositorInsertsM3-dCAS9-DNMT3A (dCas9-3A)
GFP-T2A-Puro
UseCRISPRExpressionMammalianAvailable sinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits onlyCited by