We narrowed to 9,376 results for: Ott
-
Plasmid#188739PurposeExpresses mTurqoise2 for C-terminal taggingDepositorInsertgdpA-mTurquoise PtrA
UseFilamentous fungal expressionTagsmTurquoiseAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIN6 (gpdA-nTerm-mTurqoise2-ptrA)
Plasmid#188740PurposeExpresses mTurqoise2 for N-terminal taggingDepositorInsertgdpA-mTurqoise2 PtrA
UseFilamentous fungal expressionTagsmGreenlanternAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pILGFPEasy9R
Plasmid#218291PurposePlasmid-free in-situ promoter cloning and characterisation system in S. cerevisiae, allows the characterisation of a bidirectional promoter using yEGFP and E2-Crimson as reporters.DepositorInsertpURA3>KlURA3>tKlURA3-tPGK1KanMX>tAgTEF-pMAL32>MazF(RPL28i)-E2Crimson>tPDC1-pDDI2>ISceI>tSynth3>ura3(4,191)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp21R
Plasmid#218287PurposeA complete plasmid for ToxAmp (Toxin-antitoxin-driven gene amplification) for the expression of AeBlueDepositorInsertHO(-955, -789)-LoxP>pKlLEU2>KlLEU2>PCRT1>RelB>tPDC1-pTDH3>AeBlue>tSYNth7-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp12
Plasmid#218286PurposeMulti-copy integration of heterologous genes (AeBlue and RelB) through co-transformation with ToxAmp (toxin-antitoxin-driven gene amplification) modulesDepositorInsertHO(-253, -1)-pCRT1>RelB>tPDC1-pTDH3>AeBlue>tsynth7-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp1
Plasmid#218285PurposeAmplifying the gene copy number of heterologous genes (yEGFP and RelB) through ToxAmp (toxin-antitoxin-driven gene amplification) mechanismDepositorInsertHO(-253, -1)-pRPL8B>RelB>tPDC1-pTEF1>yEGFP>tURA3-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mGCC2-FLAG
Plasmid#214166PurposeTransient expression of GCC2DepositorAvailable SinceMarch 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-mXRCC1pd-eGFP
Plasmid#206035PurposeMammalian expression of PAR-deficient mXRCC1pd coupled to eGFP under the control of a EF1a promoterDepositorInsertmXRCC1pd
TagseGFPExpressionMammalianMutationS105A, S186A, K188A, S195A, S221A, S222A,S238A, S…PromoterEf1aAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJCC_162 SpCas9 KES(1107-1109)GG
Plasmid#179526PurposeFor bacterial expression of SpCas9 KES(1107-1109)GG (phosphate lock loop mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 KES(1107-1109)GG
Tags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationreplaced KES (residues 1107-1109) with GGAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_164 SpCas9 R1333A/R1335A
Plasmid#179528PurposeFor bacterial expression of SpCas9 R1333A/R1335A (PAM-binding arginines mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 R1333A/R1335A
Tags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationchanged arginines 1333 and 1335 to alanineAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-DM-HA-GFP11-KDEL
Plasmid#177723PurposeDM Firefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFlucDM
TagsGFP11, HA, KDEL, and Prolactin Signal SequenceExpressionBacterial and MammalianMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgAAT Nicking
Plasmid#169842PurposeExpress a nicking sgRNA used for correction (via A•T-to-G•C) of the E342K mutationDepositorInsertsgAAT Nicking (SERPINA1 Human)
ExpressionMammalianAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET51b-His-TEV-SNAP-tag_dead_mt
Plasmid#167270PurposeOverexpression of the dead variant (C145A) of SNAP-tag in E. coliDepositorInsertSNAP-tag
TagsHis x10ExpressionBacterialMutationC145APromoterT7Available SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET51b-His-TEV-SNAP-tag_fast_dead_mt
Plasmid#167272PurposeOverexpression of the fast (E30R) dead variant (C145A) of SNAP-tag in E. coliDepositorInsertSNAPf-tag
TagsHis x10ExpressionBacterialMutationE30R-C145APromoterT7Available SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-10xPP7-Qb model based
Plasmid#158203PurposeCassette of 10 different binding sites with high affinity to both PP7 and Qb phage coats protein, as computed by the ML model.DepositorInsert10 binding sites with high affinity to PP7 and QB coat proteins based on the machine-learning model
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7gRNA-smyhc1_977
Plasmid#140867PurposesgRNA synthesis vector for smyhc1_977 (zebrafish slow myosin heavy chain 1).DepositorInsertzebrafish smyhc1_977 sgRNA for in vitro transcription (smyhc1 Synthetic, Zebrafish)
UseIn vitro transcription of sgrnasAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7gRNA-ttn.1_C3
Plasmid#140866PurposesgRNA synthesis vector for ttn.1_C3 (zebrafish titin .1).DepositorInsertzebrafish ttn.1_C3 sgRNA for in vitro transcription (ttn.1 Synthetic, Zebrafish)
UseIn vitro transcription of sgrnasAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS2267
Plasmid#158392PurposeHigh Copy number plasmid containing Ple341 (PCP2 MiniPromoter) insertDepositorAvailable SinceFeb. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS2279
Plasmid#158399PurposeHigh Copy number plasmid containing Ple349 (PDE6H MiniPromoter) insertDepositorAvailable SinceFeb. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits