We narrowed to 5,329 results for: Mos
-
Plasmid#168464PurposeFor the insertion pf NLS-mEos3.2-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mEos3.2-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_nocharge_wR
Plasmid#139119Purposeexpress hnRNPA2 LC with no charged residues with R added backDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R47A)
Plasmid#112722PurposeArg47 within TBP6.7 is the most critical residue in terms of forming interactions with WT TAR. Mutating this amino acid to Ala results in ~600-fold reduction in Kd.DepositorInsert6His-TEV-TBP6.7(R47A)
Tags6His-TEVExpressionBacterialMutationR47APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_EB
Plasmid#66013PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [E:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_FB
Plasmid#66014PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [F:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_GB
Plasmid#66015PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [G:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- R5A-K5A N23 C11orf83-GFP
Plasmid#65846PurposeMammalian expression of the mutated N terminal part (R5A-K5A N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- R5D-K6D N23 C11orf83-GFP
Plasmid#65847PurposeMammalian expression of the mutated N terminal part (R5D-K5D N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Magoh198delG
Plasmid#30481DepositorAvailable SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGD-p19
Plasmid#196326Purpose35S promoter-driven expression of the tomato bushy stunt virus p19 RNA silencing suppressorDepositorInserttomato bushy stunt virus p19
ExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGD-P1/HC-Pro
Plasmid#196328Purpose35S promoter-driven expression of the tobacco etch virus P1/HC-Pro RNA silencing suppressorDepositorInserttobacco etch virus P1/HC-Pro
ExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCK306
Plasmid#110544PurposerhaBAD, a rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteria.DepositorInsertsPrhaBAD
yfp
rhaS
ExpressionBacterialPromoterN/A, PrhaBAD, and kanR promoter (upstream of kanR…Available SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AvicFP4
Plasmid#129507PurposeExpresses AvicFP4 constitutively in E. coli (most strains)DepositorInsertAvicFP4
ExpressionBacterialMutationOne of two variants of AvicFP4 tested with essent…Promotersynthetic constitutive (stationary phase) promote…Available SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNMSB104
Plasmid#199314PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB84
Plasmid#199309PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, ChR2(H134R;D156C), C. elega…Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C-linker-TlcnC
Plasmid#114377Purposeexpresses Flpo recombinase-dependent GtACR2-Kv2.1C-linker-TlcnC, which targets GtACR2 to the somatodendritic compartment. Messier et al found this hybrid construct was the most effective at targetingDepositorInsertGtACR2-EYFP-Kv2.1C-linker-TlcnC (NEWENTRY )
UseAAVTagsEYFP and Kv2.1C-linker-TlcnCExpressionMammalianPromoterEf1aAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only