We narrowed to 5,297 results for: crispr cas9 expression plasmids
-
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUt-mNF-Cas13d
Plasmid#224789PurposeLPUtopia matching RMCE donor plasmid with mCherry-P2A-RfxCas13d Negative-Feedback circuit. Use BlastR for positive selection and HSV-TK for negative selection.DepositorInsertmCherry-P2A-RfxCas13d
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-UGCG-EGFP
Plasmid#225878PurposePlasmid donor template for CRISPR/Cas9 mediated UGCG knockout by EGFP insertionDepositorInsertEGFP
UseCRISPRExpressionMammalianAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-HF1
Plasmid#218156PurposeThis plasmid harbors the base editor SCBE3-HF1 along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-HF1
Plasmid#218160PurposeThis plasmid harbors the base editor SCBE3-NG-HF1 along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-Hypa
Plasmid#218161PurposeThis plasmid harbors the base editor SCBE3-NG-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N692A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-HF1-Hypa
Plasmid#218162PurposeThis plasmid harbors the base editor SCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-HF1-Hypa
Plasmid#218158PurposeThis plasmid harbors the base editor SCBE3-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-Hypa
Plasmid#218157PurposeThis plasmid harbors the base editor SCBE3-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N692A…PromoterrpsL promoterAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA-hIRF-1 #12/pSIR-hCD2
Plasmid#135392PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoterDepositorInsertgRNA_hIRF1 promoter #12
UseCRISPR and RetroviralExpressionMammalianPromoterU6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
1114H
Plasmid#200640PurposeAn. gambiae transgenesis plasmid. Expresses gRNAs targeting B2-tubulin, ZPG, and DSXF. Crossing to Cas9 generates sterile malesDepositorInsertgRNA targeting DSXF, ZPG, and B2-tubulin. Actin5c-CFP and Vasa2-EYFP reporters.
UseCRISPRExpressionInsectAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-total_SigP:NLuc
Plasmid#197267PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (both isoforms). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-total homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGG198
Plasmid#165605PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with two hEGFP protospacers: PS1(upstream of promoter with 'CAGCG' PAM)-lac-PS2(downstream with 'CGGCG' PAM)-HIS3 and GFPDepositorInserthEGFP protospacer ('CGGCG' PAM) downstream of the HIS3/GFP promoter
UseSynthetic BiologyExpressionBacterialMutationSecondary protospacer ('CGGCG' PAM) ins…PromoterlacAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mClover3_PSMD1_sgRNA_1
Plasmid#155102Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mClover3_AAVS1_sgRNA_4
Plasmid#155101Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting the AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_4
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_3
Plasmid#155086Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_3
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only