We narrowed to 14,335 results for: Ung;
-
Plasmid#127727PurposeYeast pathway position 3. CAD transcription unit with the TDH3 promoter and TDH1 terminator.DepositorInsertcis-aconitate decarboxylase
UseSynthetic BiologyExpressionYeastPromoterPtdh3Available SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T MDM2 S186D
Plasmid#16239DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-SERTS585P-myc
Plasmid#107498PurposeMammalian expression plasmid for codon optimized mutant hSERT with internal MYC tag inserted in ECL2, mutation S585P conferring gain of function phenotypeDepositorAvailable SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRI007-pGEM-PgpdA-Cas12aScaffold-BsmbI-TtrpC
Plasmid#140200PurposeCloning vector for LbCas12a crRNAs ( Step 1 of the 2-step cloning alternative). Full PgpdA sequence is reconstituted when amplifying the expression cassette for cloning in a fungal vector.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsdLbCas12a crRNA scaffoldPromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFGL1170R
Plasmid#116896PurposehH1:mCherry (nuclear marker)DepositorInsertshH1
mCherry
hH1 downstream region
UseFungal expression (in magnaporthe oryzae)Mutationno start codon, no stop codon and without start c…Promoterpromoter lessAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T MDM2 S166D
Plasmid#16238DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pHL 651
Plasmid#53016PurposeLacIq + PCon::RBS (st3) tetR::T1 terminator + p15a + CamR. Backbone from pZA32MCS1 (Lutz and Bujard, 1997).DepositorInsertsLacIq
tetR
UseSynthetic BiologyTagsRBS(st3) and T1 terminatorExpressionBacterialPromoterpConAvailable SinceMay 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHL 1277
Plasmid#53017PurposeAmpR + PLtetO-1::RBS (st7) gfp::T1 terminator + PLlacO-1::RBS (st7) mCherry::Asp terminator + ColE1DepositorInsertsGFP
mCherry
UseSynthetic BiologyTagsRBS(st7)ExpressionBacterialPromoterpLlacO-1 and pLtetO-1Available SinceMay 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter hsa-mir-138-2
Plasmid#46677DepositorInserthsa-mir-138-2 (MIR138-2 Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianPromoterCMVAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only