We narrowed to 5,380 results for: Mos;
-
Plasmid#173807PurposeExpression and purification of mature (no signal sequence) human alpha1-antitrypsin wildtype variant M1V (UniProt P01009) from E. coli BL21(DE3) cellsDepositorInsertSERPiNA1 (SERPINA1 Human)
ExpressionBacterialMutationE1M Otherwise this plasmid encodes the most commo…PromoterT7Available SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBI121::smEclipGFP:AQ
Plasmid#240454PurposeExpression of indicator protein fusion (soluble modified ecliptic pHluorin & Aequorin) for monitoring calcium concentrations and pH in the cytoplasm of higher plants. See Resource Information.DepositorInsertFusion of soluble modified ecliptic pHluorin and Aequorin
ExpressionBacterial and PlantMutationEcliptic GFP (ecliptic pHluorin) (PMID 9671304); …PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF
Plasmid#100280PurposeExpression vector for phycocyanobilin (PCB) synthesis in mammalian cells.DepositorInsertMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoterAvailable SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pATP416-pluxO5-pphlO6-crtYBI
Plasmid#165977PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and 2,4-diacetylphloroglucinol in yeast expressing PhlTA and LuxTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTH733-2µ-RLuc/maxCFLuc
Plasmid#40608DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-NFLAG-hFUS
Plasmid#50487PurposeProduces lentivirus expressing human FUS with FLAG tag at its N-terminus by co-transfection with psPAX2 and pMD2GDepositorAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pATP416-pluxO5-ptetO7-crtYBI
Plasmid#165975PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and doxycycline in yeast expressing LuxTA and rtTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8-CYP2A6(C14A, C82A, C439A)-flag-tev-halo-his
Plasmid#227164PurposeFor T-REX experiments of CYP2A6 C14A, C82A, and C439A triple mutant. Almost no sensing ability to reactive electrophilic species (RES).DepositorInsertCYP2A6 (CYP2A6 Human)
TagsFlag, HaloTag, and His6ExpressionMammalianMutationchanged cysteine 14, cysteine 82, and cysteine 43…PromoterCMV and SP6Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC18 Apln5-HA-FlpO-pA-LoxP-PGK-Neo-pA-LoxP-Apln3 (SO89)
Plasmid#159222PurposeCan be used to target the mouse Apln locus in mouse eggs or ES cells, in order to drive the mosaic expression of the protein HA-NLS-FlpODepositorInsertApln 5'-FlpO-WPRE-Sv40pA-LoxP-PGK-Neo-pA-LoxP-Apln
ExpressionMammalianPromoterAplnAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Bod1l_Anti-Sense
Plasmid#124444PurposePlasmid for anti-sense in situ probe in vitro transcriptionDepositorInsertBiorientation of chromosomes in cell division 1-like (Bod1l Mouse)
UseIn situ probePromoterT7Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Antibody#251704-rAbPurposeAnti-ROBO1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse ROBO1. Does not cross-react with other ROBOs.DepositorArticleRecommended ApplicationsFlow Cytometry, Immunocytochemistry, and ImmunohistochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMarch 13, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#251721-rAbPurposeAnti-ROBO3 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse ROBO3. Does not cross-react with other ROBOs.DepositorArticleRecommended ApplicationsFlow Cytometry, Immunocytochemistry, and ImmunohistochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMarch 13, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pET-28a(+)-FGF2-G3
Plasmid#135521PurposeEngineered form of fibroblast growth factor 2 with improved thermostabilityDepositorInsertfibroblast growth factor 2 (FGF2 Human)
Tags6x His tag and Agg Thrombin TagExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 PromoterAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
EF1a_Puro_Telo_v1
Plasmid#195138Purpose~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss inductionDepositorInsertTelomere (RTEL1 Human)
ExpressionMammalianAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-Myo10
Plasmid#135403PurposeExpresses GFP-tagged bovine Myo10 in mammalian cells.DepositorInsertMyo10 (MYO10 Bovine)
TagsEGFPExpressionMammalianMutation"Relative to the GenBank Myo10 cDNA sequence…PromoterCMVAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTH753-CEN-RLuc/min346maxCFLuc
Plasmid#38219DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 346 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
EF1a_Puro_Telo_v2
Plasmid#195139Purpose~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss inductionDepositorInsertTelomere (RTEL1 Human)
ExpressionMammalianAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only