We narrowed to 9,786 results for: CAG
-
Plasmid#133364PurposePiggybac vector for shRNA-mediated knockdown, co-expressed with FUCCI cell cycle reporterDepositorInsertClover-Geminin-IRES-mKO2-Cdt1
TagsHA-tagged Clover-GemininExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_A
Plasmid#72620PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pBBK21 pCAS-Tyr-[gRNA: 4=XII-5] (SplitHygR, AmpR)
Plasmid#179005PurposeSp.Cas9 and gRNA yeast expression vector withXII-5 gRNA pre-cloned. Selection =SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBMN-AS-HNF4α
Plasmid#139305PurposeKnocking down of human HNF4α through shRNA and amiRNA targeting HNF4αDepositorInsertshRNA and amiRNA against HNF4α
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR U6:gRNA cdkn2a, mitfa:Cas9
Plasmid#118842PurposeTargets cdkn2a and expresses zebrafish mitfa specifically in zebrafish melanocytesDepositorInsertcdkn2a gRNA (LOC100329528 Zebrafish)
UseCRISPR; Tol2Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-SUV39h1 ts2
Plasmid#115881PurposeSUV39h1 knockdownDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
shCDK4/6(1)
Plasmid#73554Purposevector encoding both shRNA against CDK4(1) and shRNA against CDK6(1)DepositorInsertshRNA against CDK4 + shRNA against CDK6
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-STAG2 shRNA 1221
Plasmid#31978DepositorAvailable SinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUPERIORpuro-shGAS5
Plasmid#46370DepositorAvailable SinceAug. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
Luciferase shRNA
Plasmid#225343PurposeshRNAmir backbone for RNA interference, with YFPDepositorAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgUBA5
Plasmid#86132PurposeLentiviral vector expressing Cas9 and an sgRNA targeting UBA5DepositorAvailable SinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-SPARCL1-C-mCherryTag
Plasmid#218183PurposeTo tag Hevin with mCherry at its C-terminalDepositorInsertsgRNA (Sparcl1 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_version2_U6_AtPDS3_gRNA10
Plasmid#197952PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the C-terminal , and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.1039
Plasmid#105566Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_TFRC_B
Plasmid#72626PurposeExpresses two gRNAs targeting the TFRC promoterDepositorInsertgRNAs toward TFRC
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
p231-pOsAct1::hpt-pZmUbi::BdPetC-p35S::mTurquoise
Plasmid#129650PurposeRieske FeS overexpressionDepositorInsertCDS of PetC gene encoding for the Rieske FeS subunit
ExpressionPlantMutationCodon modified for Golden GatePromoterpZmUbiAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only