We narrowed to 8,466 results for: cat.2
-
Plasmid#134897PurposeExpresses HIS-Avi-tagged ubiquitin for recombinant protein productionDepositorInsertsTags10HIS-AviTag-PreScission(3C)proteaseExpressionBacterialPromoterRBS and T7Available SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.TRC1.shmNsd1.1, puro
Plasmid#114446PurposeLentiviral vector for expression of shRNA sequence targeting mouse Nsd1DepositorInsertshNsd1.1 (Nsd1 Mouse)
UseLentiviral and RNAiAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL12
Plasmid#107918Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Flag-neo-PP1-Alpha-H248K
Plasmid#171268PurposeMammalian expression of 3x-Flag-tagged human PP1 alpha catalytic subunit H248K mutant that loses enzymatic activityDepositorInsert3x-Flag-tagged human PP1 alpha catalytic subunit H248K mutant (PPP1CA Human)
TagsFlagExpressionMammalianMutationPPP1CA-His248Lys (H248K)PromoterCMVAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-DEPTOR S286/287/291A
Plasmid#159160PurposeExpresses DEPTOR S286/287/291A mutant in mammalian cellsDepositorInsertDEPTOR (DEPTOR Human)
TagsHAExpressionMammalianMutationchanged serine 286,287 and 291 to alaninePromoterCMVAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-DEPTOR S286/287/291D
Plasmid#159161PurposeExpresses DEPTOR S286/287/291D mutant in mammalian cellsDepositorInsertDEPTOR (DEPTOR Human)
TagsHAExpressionMammalianMutationchanged serine 286,287 and 291 to aspartic acidPromoterCMVAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL10
Plasmid#107916PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL17
Plasmid#107923PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmKO-imp α
Plasmid#200082PurposeExpresses mKO-tagged human importinα in mammalian cellsDepositorAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMEL15
Plasmid#107921Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPKm-230
Plasmid#90499PurposepSIN - EF-1alpha - PIF3 - MTAD - IRES - PhyB - GBD, dual vector of PIF3-MTAD under EF-1 alpha promoter and PhyB-DBD under IRES promoter; See growth conditions below.DepositorInsertmito-tFD and mito-tFNR
UseLentiviralAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL14
Plasmid#107920PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTriEx4-ADCY6-C2 (917-1165 aa)
Plasmid#113904PurposeHis-S tagged cytoplasmic catalytic domain 2 of Adenylate Cyclase 6DepositorInsertAdenylate Cyclase 6 cytoplasmic catalytic domain 2 (ADCY6 Human)
TagsHis-SExpressionBacterial, Insect, and Mamm…MutationPlease see Depositor CommentsPromoterT7, CMVAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.TRC1.shmNsd1.2, puro
Plasmid#114447PurposeLentiviral vector for expression of shRNA sequence targeting mouse Nsd1DepositorInsertshNsd1.2 (Nsd1 Mouse)
UseLentiviral and RNAiAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL11
Plasmid#107917PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-IRSp53(trunc C2)
Plasmid#221274PurposeExpression of IRSp53 C-terminal truncation 2 (247-335) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ3A
Plasmid#197513PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-3 σ3A fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-3 σ3A
TagsGAL4-DNA binding domain fragment, HA tag, and nuc…ExpressionYeastMutationsilent substitution in codon 2 of tyrosinase tail…PromoterADH1 and MET25Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR207-MUM2sp-Citrine-ADPG2
Plasmid#170725PurposeGateway (Invitrogen) entry clone (pDONR207) containing the MUM2 (At5g63800) signal peptide (84bp) fused in-frame to the Citrine and the coding sequence of the HG degrading enzyme ADPG2 (At2g41850.1)DepositorInsertARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2 (PGAZAT Mustard Weed)
UseGateway donor vector / entry cloneTagsCitrine tag (714bp)Available SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only