We narrowed to 11,399 results for: nar
-
Plasmid#127091PurposeAn AAV genome with Cre-dependent expression of tTA from the CAG promoterDepositorInserttTA
UseAAVExpressionMammalianMutation*(see below)PromoterCAGAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S612
Plasmid#58914Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S612 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S612 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S608
Plasmid#58913Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S608 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S608 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
mTiam1-mcherry-sspB in pcDNA3.1
Plasmid#85221PurposeRole of Rac selective GEF domain from Tiam1 in immune cell migrationDepositorAvailable SinceJan. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJM671 EF1α TC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF6 in TUPV3
Plasmid#161573PurposeConstitutive expression of TC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF6 under the EF1α promoterDepositorInsertTC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF6
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterEF1αAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-(STChRger2-TS-EYFP)
Plasmid#129394PurposeSoma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Uses the CAG promoter and double floxed.DepositorInsertsoma targeted ChRger2
UseAAV and Cre/LoxTagsKv2.1-TS-EYFPExpressionMammalianPromoterCAGAvailable SinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-tdTomato-f
Plasmid#127092PurposeAn AAV genome with tet-inducible, Cre-dependent expression of farnesylated (f) tdTomatoDepositorInserttdTomato-f
UseAAVTagsfarnesylation signal from c-Ha-RasExpressionMammalianAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pRP(Exp)-CMV> ORF_924bp (Azgp1):T2A:dTomato:IRES:Puro
Plasmid#110830PurposeExpresses zinc alpha-2 glycoprotein (ZAG) and dTomato (dT) reporter where both sequences are separated by a T2A self-cleaving peptide sequence as a result, the dT is not fused with the ZAG protein.DepositorAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EphB4-Fc
Plasmid#200986PurposeMammalian expression plasmid for soluble EphB4 fused to IgG1 FcDepositorInsertEphB4 (EPHB4 Human)
TagsFc region of human IgG1ExpressionMammalianMutationSoluble ectodomain of EphB4PromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S780
Plasmid#58915Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S780 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S780 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PM-InPAkt
Plasmid#181915PurposeIndicator of Phosphoinositides using Akt; targeted to the plasma membrane.DepositorInsertpm-InPAkt
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationContains the following mutations with respect to …PromoterCMVAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pJM612 EF1α TC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF1 in TUPV3
Plasmid#161571PurposeConstitutive expression of TC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF1 under the EF1α promoterDepositorInsertTC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterEF1αAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pCMV HA hRB delta CDK + S811
Plasmid#58919Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S811 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S811 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S807
Plasmid#58918Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S807 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S807 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S788
Plasmid#58916Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S788 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S788 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + T356
Plasmid#58911Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and T356 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with T356 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only