We narrowed to 4,237 results for: 272
-
Plasmid#84884PurposerAAV-based template for genome engineering of the p53 C-terminus containing PQS1 and 3xFLAG tags and a selection cassetteDepositorInsertsUseAAVTagsPQS1 3xFLAGPromoterno and noAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pAav-MDM2-PQS2-3xHA
Plasmid#84886PurposerAAV-based template for genome engineering of the MDM2 protein C-terminus containing PQS2 and 3xHA tags and a selection cassetteDepositorUseAAVTagsPQS2 3xHAPromoternoAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-ACE2-A2
Plasmid#188687PurposesgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-ACE2-A4
Plasmid#188688PurposesgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_hACE2_PURO
Plasmid#155295PurposeLentiviral vector to generate hACE2 stable expressing cell lineDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pWPI-IRES-Puro-Ak-ACE2
Plasmid#154985PurposeLentiviral vector expressing Human ACE2DepositorInsertACE2 (ACE2 Human)
UseLentiviralAvailable SinceJuly 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWPI-IRES-Bla-Ak-ACE2
Plasmid#154981PurposeLentiviral vector expressing Human ACE2DepositorInsertACE2 (ACE2 Human)
UseLentiviralAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
R777-E093 Hs.FNTA
Plasmid#70377PurposeGateway ORF clone of human FNTA [NM_002027.2] with stop codon (for native or N-terminal fusions)DepositorInsertFNTA (FNTA Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Endophilin Full
Plasmid#47408DepositorInsertEndophilin
TagsGSTExpressionBacterialPromotertacAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR223 ACE2, open
Plasmid#149719PurposeFor Gateway cloning of ACE2 into destination vectorDepositorAvailable SinceJune 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
R777-E094 Hs.FNTA-nostop
Plasmid#70378PurposeGateway ORF clone of human FNTA [NM_002027.2] without stop codon (for C-terminal fusions)DepositorInsertFNTA (FNTA Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Endophilin SH3 domains
Plasmid#47401DepositorInsertEndophilin
TagsGSTExpressionBacterialMutationSH3 domain (aa 292-352)PromotertacAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHDX-donor
Plasmid#176353PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceNov. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCellFree_KA1_Human-ACE2
Plasmid#169406PurposeCell-free/mammalian expression vector for Human ACE2 receptor with N-term eGFPDepositorInsertHuman ACE2 receptor (ACE2 Human)
UseCell-free expression vectorTagsHis and eGFPPromoterT7- CMV/CAGAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-As-crRNA
Plasmid#78956PurposeCloning vector for expression of AsCpf1 crRNA. It contains BsmB1 site for cloning.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-Lb-crRNA
Plasmid#78957PurposeCloning vector for expression of LbCpf1 crRNA. It contains BsmB1 site for cloning.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-ACE2-puro
Plasmid#158448PurposeConstitutive lentiviral expression of human ACE2.DepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-ACE2-blast
Plasmid#158449PurposeConstitutive lentiviral expression of human ACE2.DepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ACE2
Plasmid#158438PurposeGateway Cloning compatible entry vector for the human ACE2 gene.DepositorInsertACE2 (ACE2 Human)
UseGateway entry vectorAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only