We narrowed to 5,769 results for: org
-
Plasmid#107928PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS
Plasmid#98566PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
ATP-dependent Clp protease adapter protein
UseTagsExpressionBacterialMutationIn a synthetic operon downstream of UBP1 and Remo…PromoterSame as UBP1 (operon) and Tet promoter (aTc induc…Available sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF716
Plasmid#101481PurposeDonor Vector containing ZNF716 transcription factor, part of the Human TFome CollectionDepositorInsertZNF716 (ZNF716 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF808
Plasmid#101470PurposeDonor Vector containing ZNF808 transcription factor, part of the Human TFome CollectionDepositorInsertZNF808 (ZNF808 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRRLsin.PPT.CMV‐GFP‐Eps8 WT
Plasmid#74922PurposeLentiviral plasmid expressing Eps8 fused to GFPDepositorInsertEps8 (Eps8 Mouse)
UseLentiviralTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF442
Plasmid#101455PurposeDonor Vector containing ZNF442 transcription factor, part of the Human TFome CollectionDepositorInsertZNF442 (ZNF442 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-4
Plasmid#133404Purposehuman ETV6 gRNA-3 and 4 is a pair of gRNAs. Four ETV6 gRNA plasmids used the same backbone(Addgene plasmid#41824). ETV6 gRNA-4 target the second ETV6 exon.DepositorInsertETV6 (ETV6 Human)
UseTagsExpressionMammalianMutationPromoterU6Available sinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNK091
Plasmid#219769PurposeMoClo-compatible Level P vector carrying fungal bioluminescence system lacking luciferase geneDepositorInsertpNos-KanR-ocsT | p35S-nnHispS-ocsT | pCmYLCV-npgA-ATPT | p35S-nnCPH-ocsT | pFMV-nnH3H-nosT
UseSynthetic BiologyTagsExpressionPlantMutationPromoterpNos-KanR-ocsT | p35S-nnHispS-ocsT | pCmYLCV-npgA…Available sinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-HHEX
Plasmid#222928PurposePiggyBac transposon plasmid for doxycycline inducible expression of HHEXDepositorInsertHHEX (HHEX Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF883
Plasmid#101608PurposeDonor Vector containing ZNF883 transcription factor, part of the Human TFome CollectionDepositorInsertZNF883 (ZNF883 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF234
Plasmid#101611PurposeDonor Vector containing ZNF234 transcription factor, part of the Human TFome CollectionDepositorInsertZNF234 (ZNF234 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF233
Plasmid#101558PurposeDonor Vector containing ZNF233 transcription factor, part of the Human TFome CollectionDepositorInsertZNF233 (ZNF233 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF516
Plasmid#101566PurposeDonor Vector containing ZNF516 transcription factor, part of the Human TFome CollectionDepositorInsertZNF516 (ZNF516 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF579_isoform2
Plasmid#101569PurposeDonor Vector containing ZNF579 transcription factor, part of the Human TFome CollectionDepositorInsertZNF579 (ZNF579 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXD4L5
Plasmid#101492PurposeDonor Vector containing FOXD4L5 transcription factor, part of the Human TFome CollectionDepositorInsertFOXD4L5 (FOXD4L5 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXD4L1
Plasmid#101510PurposeDonor Vector containing FOXD4L1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXD4L1 (FOXD4L1 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF852_isoform1
Plasmid#101533PurposeDonor Vector containing ZNF852 transcription factor, part of the Human TFome CollectionDepositorInsertZNF852 (ZNF852 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF665
Plasmid#101448PurposeDonor Vector containing ZNF665 transcription factor, part of the Human TFome CollectionDepositorInsertZNF665 (ZNF665 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only