We narrowed to 9,800 results for: CAG
-
Plasmid#251691PurposegRNA to knock out MT1E in mammalian cellsDepositorInsertMT1E metallothionein 1E (MT1E Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMT1X-1
Plasmid#251692PurposegRNA to knock out MT1X in mammalian cellsDepositorInsertMT1X metallothionein 1X (MT1X Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrambled-GFP
Plasmid#228736PurposeGFP expressing scramble of shRNA targeting Miro1DepositorAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shAtg7-EGFP
Plasmid#227684PurposeExpresses EGFP and shRNA targeting Atg7DepositorInsertAtg7 shRNA (Atg7 Mouse)
ExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d sgCiPELO #8
Plasmid#228934PurposeExpression of dCas9-KRAB and sgRNA targeting PELODepositorInsertPELO gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pColdI-SBP-DDX3_helicase_core
Plasmid#233622PurposeExpression of SBP-tagged helicase core region of DDX3X in E.coliDepositorAvailable SinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2 PQBP1 KO1
Plasmid#217447PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human PQBP1DepositorAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2703-AGER-gRNA2
Plasmid#216472Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(PRDM14_v32_7-6)-PGKpuroBFP-W
Plasmid#211983PurposeExpress gRNA against PRDM14 with puro and BFPDepositorInsertsgRNA targeting PRDM14 (PRDM14 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ACIN1_sgRNA2
Plasmid#201589PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertACIN1 (ACIN1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #1
Plasmid#198759Purposeconditional knockdown of FDPSDepositorInsertshFDPS #1 (FDPS Human)
ExpressionMammalianAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Flnc
Plasmid#174870PurposeCRISPR vector for generating Flnc STREAMING-tag KI cellDepositorInsertsgRNA for mouse Flnc (Flnc Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSpen#2/Cre
Plasmid#193240PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgUbr5#2/Cre
Plasmid#173624PurposeExpresses a Ubr5-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ubr5 (Ubr5 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf1#1/Cre
Plasmid#173607PurposeExpresses a Nf1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf1 (Nf1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_2
Plasmid#155066PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_1
Plasmid#155069PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_1
Plasmid#155073PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only