We narrowed to 6,965 results for: mag
-
Plasmid#105850PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG3-derived CH1 and hinge.DepositorUseTagsExpressionMammalianMutationhybrid heavy chain of mouse IgG1 with CH1 and hin…PromoterhEF1-HTLV promAvailable sinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pDONR221-SARS-CoV-2 S1 RBD
Plasmid#167013PurposeGateway-compatible Entry vector encoding spike (S1) RBD domain from SARS-CoV-2DepositorInsertS (S SARS-CoV-2 isolate Wuhan-Hu-1)
UseTagsExpressionMammalianMutationNo stop codonPromoterAvailable sinceApril 5, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Desmoplakin I tension sensor (F40-based)
Plasmid#118725PurposeThe F40-based human desmoplakin I tension sensor detects forces in the range of 1-6 pN by changes in FRET between YPet(short) and mCherry.DepositorInserthuman Desmoplakin I-[YPet(short)-F40-mCherry] (internal-1952) (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherryExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-ZIP(FF)
Plasmid#27135DepositorUseLentiviralTagseGFP and mCherryExpressionMammalianMutationTyrosines in ITAMS 1-3 mutated to phenylalanines …PromoterAvailable sinceApril 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_h-3
Plasmid#105854PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG3-derived hinge.DepositorUseTagsExpressionMammalianMutationhybrid heavy chain of mouse IgG1 with hinge deriv…PromoterhEF1-HTLV promAvailable sinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Gal4 PGC1 alpha L2/3A
Plasmid#8898DepositorInsertPGC-1a (Ppargc1a Mouse)
UseTagsGal4 DBDExpressionMammalianMutationLXXLL at aa140 is changed to AXXLL; LLXXL at aa 2…PromoterAvailable sinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-eGFP-NLS-RNF168 delta RING
Plasmid#133983Purposemammalian expression vector of eGFP tagged RNF168 where the N-terminus of RNF168 has been deleted (including RING domain)DepositorInsertRNF168 (RNF168 Human)
UseTagseGFPExpressionMammalianMutationdeletion of RING; siRNA resistant sequence: GAGGA…PromoterCMVAvailable sinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
Desmoplakin II no force control (F40-based)
Plasmid#118716PurposeThe no force control for the F40-based human desmoplakin II tension sensor serves to detect changes in FRET between YPet(short) and mCherry that are tension-independent.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-F40-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherryExpressionMammalianMutationtruncation after aa1353PromoterCMVAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP(TD)
Plasmid#61521PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIP with TD mutationDepositorInsertFK506 binding protein 1A (FKBP1A Human)
UseTagsAIP with TD mutation (see comments), Tom20, and m…ExpressionMammalianMutationTD mutation (see comments)PromoterCMVAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ashL344P-mKate2-splitmVenusN
Plasmid#69586PurposeExpresses mutated p53-L344P tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344P (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344P mutation that prevents dimerization and…PromoterEF1alphaAvailable sinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
UseTagsExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5E-hs_UbiC-pro (JDW 1461)
Plasmid#242547PurposeEnhancer/Promoter: Gateway 5' entry vector containing human Ubc promoter (-1225 to -6)DepositorInsertUbiquitin / Ubc promoter (UBC Human)
UseGateway subcloningTagsExpressionMutationPromoterAvailable sinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_1
Plasmid#242897PurposePiggyBac cargo vector with HNRNPK sgRNA 1 for dox-inducible knockdownDepositorInsertHNRNPK (Hnrnpk Mouse)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_3
Plasmid#242898PurposePiggyBac cargo vector with HNRNPK sgRNA 3 for dox-inducible knockdownDepositorInsertHNRNPK (Hnrnpk Mouse)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-Af1521(K35E/Y145R)-myc
Plasmid#196241PurposeN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
UseTagsGST tag and myc tagExpressionBacterialMutationamino acid 35 lysine is replaced with glutamic ac…PromoterAvailable sinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-pSyn_R-PTEN
Plasmid#227437PurposeExpression of the R-PTEN sensor under the Synapsin promoter in an AAV backboneDepositorInsertR-PTEN sensor (Pten Rat)
UseAAVTagsmCyRFP2 and mMaroonExpressionMammalianMutationR14GPromoterSynapsinAvailable sinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-2
Plasmid#237635PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorInsertHP1a gRNA (CBX5 Human)
UseCRISPRTagsmCherryExpressionMutationPromoterAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX1-KS
Plasmid#237679PurposeFor overexpression of mEGFP-SS18-SSX1-KSDepositorUseTagsmEGFPExpressionMammalianMutationPromoterAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX1
Plasmid#237678PurposeFor overexpression of mEGFP-SS18-SSX1DepositorUseTagsmEGFPExpressionMammalianMutationPromoterAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX2-KS
Plasmid#237680PurposeFor overexpression of mEGFP-SS18-SSX2-KSDepositorUseTagsmEGFPExpressionMammalianMutationPromoterAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only