We narrowed to 14,243 results for: crispr grnas
-
Plasmid#220989PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2260 hNOLC1 atgRNA Paired Guide 2
Plasmid#220990PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPW3754 : pUC-SpCas9_gRNA-HsIRE1-Cterm
Plasmid#185676PurposeSpCas9 and gRNA targeting the C-terminus of HsIRE1DepositorInsertERN1 gRNA (ERN1 Human)
UseCRISPRAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
783-Rx-mU6: RfxCas13d gRNA and array cloning backbone
Plasmid#228361PurposemU6-driven expression of RfxCas13d gRNAs and arrays. Contains AarI sites for guide cloning.DepositorTypeEmpty backboneUseCRISPR and Lentiviral; Rfxcas13d grna expression …ExpressionMammalianPromotermU6Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBW1942_ hU6-PV2-lox2272-BbsI-ENTRY-gRNA
Plasmid#89055PurposePV2 gRNA entry vector for CRISPR decoderDepositorTypeEmpty backboneUseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBW1720_hU6-PV1-FRT-lox2272-BbsI-ENTRY-gRNA
Plasmid#89053PurposePV1 gRNA entry vector for CRISPR decoderDepositorTypeEmpty backboneUseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-PGK- mRFP-T2A-PuroR
Plasmid#194925PurposemRFP and T2A linker are inserted in between the hPGK promoter and the puromycin resistance gene (PuroR) on pGL3-U6-sgRNA-PGK-puromycin to allow simultaneous monitoring and enrichment of transfected hoDepositorTypeEmpty backboneUseCRISPRPromoterhPGKAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
TBP6.7 non-targeting gRNA lambda phage
Plasmid#132547Purposeexpresses gRNA for TBP-based CIRTSDepositorInsertgRNA TBP-based CIRTS
ExpressionMammalianPromoterhU6 promoterAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDAS12230_pegRNA-PEAR-GFP(10PBS-24RT)-mCherry
Plasmid#177182Purposeplasmid expressing a pegRNA targeting the PEAR-GFP plasmid along with an mCherry markerDepositorInsertpegRNA targeting the PEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
SLBP non-targeting gRNA lambda phage
Plasmid#132548Purposeexpresses gRNA for SLBP-based CIRTSDepositorInsertgRNA SLBP-based CIRTS
ExpressionMammalianPromoterhU6 promoterAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1.linker_KO
Plasmid#164688PurposeFor CRISPR knockout of miR-144~451 linker region by lentiviral delivery of Cas9 and linker gRNADepositorInsertmiR-144~451 linker CRISPR KO gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DPB
Plasmid#164989PurposeExpression of gRNA targeting HLA-DPB locus, including DPB1*01:01:01DepositorInsertgRNA against HLA-DPB1*01:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DQB
Plasmid#164991PurposeExpression of gRNA targeting HLA-DQB locus, including DQB1*05:01:01DepositorInsertgRNA against HLA-DQB1*05:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DRB
Plasmid#164992PurposeExpression of gRNA targeting HLA-DRB locus, including DRB1*01:02:01DepositorInsertgRNA against HLA-DRB1*01:02:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DQA
Plasmid#164990PurposeExpression of gRNA targeting HLA-DQA locus, including DQA1*01:01:01DepositorInsertgRNA against HLA-DQA1*01:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DPA
Plasmid#164988PurposeExpression of gRNA targeting HLA-DPA locus, including DPA1*02:01:08DepositorInsertgRNA against HLA-DPA1*02:01:08
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3_nsgRNA(PP7)
Plasmid#232444PurposensgRNA for PE3 facilitation of a +1 T to A prime edit on the HEK3 locus, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3) for HEK3+1t>a edit driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_pegRNA_(PP7-C4-Q1)
Plasmid#232433PurposepegRNA with optimized 3' modifications to correct the rd6 mutationDepositorInsert3'-PP7-tagged pegRNA for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_nsgRNA(PP7)
Plasmid#232434PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only