We narrowed to 20,306 results for: IRE
-
Plasmid#154262PurposeDestabilized firefly luciferase reporter containing the downstream Human IGF-1 P2 Promoter.DepositorAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pB-TR-hSOD1
Plasmid#232478PurposeTetracycline inducible PiggyBac vector expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
MLRV3:HRE-P53-MAPK/JNK-FOXO-TGFβ
Plasmid#178320PurposeMultiplex luciferase reporter vector, with luciferase reporters for the pathways HRE, P53, AP-1, FOXO and SMAD.DepositorInsertsHRE RedFirefly reporter
P53 FLuc reporter
AP-1 Renilla reporter
FOXO NLuc Reporter
SMAD GrRenilla reporter
UseLuciferase and Synthetic BiologyExpressionMammalianAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-hSNCA-NE
Plasmid#102366PurposeLentiviral overexpression of synuclein alphaDepositorInsertsynuclein alpha (SNCA Human)
UseLentiviralTagsNEExpressionMammalianMutationA silent mutation (333bp downstream of ATG) was i…PromoterEF-1aAvailable SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PIG-MycT58A
Plasmid#177648PurposeExpression of mouse Myc with T58A point mutationDepositorInsertMyc-T58A (Myc Mouse)
UseRetroviralTagsGFP and IRESExpressionMammalianMutationT58A point mutationAvailable SinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hCAII
Plasmid#232480PurposeTetracycline inducible PiggyBac vector expressing human CAII gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHuman carbonic anhydrase II (CA2 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PIG-Myc
Plasmid#177650PurposeExpression of wild-type mouse MycDepositorAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tol2-pA-GI-wt1bDNNterm-E1b-5xUAS-E1b-eGFP-GI-pA-Tol2; gcryst:CFP
Plasmid#135766PurposeThis plasmid can be used to express independently eGFP and a zebrafish wt1b dominant negative isoform (N-terminal domain) from a bidirectional 5xUAS. Also CFP expression under crystallin promoter.DepositorAvailable SinceJan. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PCTK3
Plasmid#23710DepositorInsertPCTK3 (CDK18 Human)
UseGateway CloningAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB-CuR-hSOD1
Plasmid#232477PurposeThe inducible PiggyBac Cumate Switch vector (PBQM812A-1 System Biosciences) expressing human SOD1gene including flag -tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-CuOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-N-3HA-SREBP2-C-Flag
Plasmid#134287PurposeLentivector encoding 3XHA (N-term) and Flag (C-term)-tagged SREBP2DepositorInsertSREBP2 (Srebf2 Mouse)
UseLentiviralTags3x HA and FlagExpressionMammalianMutationmouse SREBP2 precursorPromoterCMVAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX-NLS-HA-TurboID
Plasmid#215075PurposeExpresses NLS-HA-TurboID in mammalian cells from a lentiviral vector.DepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2
Plasmid#74050Purposeretroviral expression plasmid for human NFATc2/CDepositorInserthuman NFATc2, isoform C (NFATC2 Human)
UseRetroviralTagsno tagExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…PromoterpMSCV-LTRsAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-N-3HA-SREBP1-C-Flag
Plasmid#134286PurposeLentivector encoding 3XHA (N-term) and Flag (C-term)-tagged SREBP1DepositorInsertSREBP1 (Srebf1 Mouse)
UseLentiviralTags3x HA and FlagExpressionMammalianMutationmouse SREBP1 isoform a precursorPromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSCV40-EF1a-hBCL10-SO
Plasmid#75256Purposeretroviral expression vector for expression of StrepOne-Tagged human BCL10DepositorInsertBcl10 (BCL10 Human)
UseRetroviralTagsStrepOne TagExpressionMammalianPromoterpMSCV-LTRs, EF1aAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMThy1.1_hDDX5_FL
Plasmid#88873Purposeconstitutive expression of DDX5 in mammalian cellsDepositorAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
DSPQ-HTT-TALEN2 BSD
Plasmid#92246PurposeTALEN targeting downstream of HTT gene (ELD) with Blasticidin selection, forms obligate heterodimer with DSPQ-HTT-TALEN1 ZEO. TALEN: NN, HD, NN, NN, HD, NG, NN, NI, NN, NN, HD, NI, NN, HD, NI, NNDepositorInsertTALEN
UseTALENPromoterCAGAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only