We narrowed to 6,481 results for: siae
-
Plasmid#238318PurposeScVip1-536-1107-R547A protein expression in insect cellsDepositorInsertVIP1 (VIP1 Budding Yeast)
TagsHis10-Tag, Twin-Strep-tag, TEVExpressionInsectMutationScVip1-536-1107-R547AAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBB3-ScVip1-536-1107-R551A
Plasmid#238320PurposeScVip1-536-1107-R551A protein expression in insect cellsDepositorInsertVIP1 (VIP1 Budding Yeast)
TagsHis10-Tag, Twin-Strep-tag, TEVExpressionInsectMutationScVip1-536-1107-R551AAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBB3-ScVip1-536-1107-E991A
Plasmid#238321PurposeScVip1-536-1107-E991A protein expression in insect cellsDepositorInsertVIP1 (VIP1 Budding Yeast)
TagsHis10-Tag, Twin-Strep-tag, TEVExpressionInsectMutationScVip1-536-1107-E991AAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBB3-ScVip1-536-1107-H651A
Plasmid#238323PurposeScVip1-536-1107-H651A protein expression in insect cellsDepositorInsertVIP1 (VIP1 Budding Yeast)
TagsHis10-Tag, Twin-Strep-tag, TEVExpressionInsectMutationScVip1-536-1107-H651AAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAL007
Plasmid#233866PurposeMoClo-YTK URA multigene plasmid with MCS; NS3 systems; pTDH3-LexA-NLS-NS3-V1-VP48-2xOaf1-tADH1; lexAO6-pLEU2m-MCS-tENO2DepositorInsertpTDH3-LexA-NLS-NS3-V1-VP48-2xOaf1-tADH1; lexAO6-pLEU2m-MCS-tENO2
ExpressionYeastAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO359
Plasmid#235750PurposeProtein expression of FL ScVPS34 and FL ScVPS15-ZZDepositorTags3xTEV-ZZExpressionYeastMutationS2A, aa 3-887 and T134A, I851RPromoterGAL-TDH3Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEW66
Plasmid#232794PurposeCOMPASS Fragment 1 (Cps60, Cps50, Cps35, Cps25, Cps15) in PBIG1aDepositorInsertTagsNo tagsExpressionInsectPromoterpolyhedrin promoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRHA
Plasmid#232994PurposeGalactose iduced expression of Gcn4 SATtoG KtoRHAin yeastDepositorInsertGcn4 SATtoG KtoR
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoR
Plasmid#232961PurposeGalactose iduced expression of Gcn4 ATtoG KtoR in yeastDepositorInsertGcn4 SATtoG KtoR
TagsTEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRGFP
Plasmid#233006PurposeGalactose iduced expression of Gcn4 SATtoG KtoRGFP in yeastDepositorInsertGcn4 SATtoG KtoR
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol W
Plasmid#232977PurposeGalactose iduced expression of Gcn4 solvvol W+ in yeastDepositorInsertGcn4 solvvol W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 SATtoG KtoR
Plasmid#231861PurposeBacterial expression of N-terminally 6His tagged Gcn4 SATtoG KtoRDepositorInsertGcn4 SATtoG KtoR
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterT7Available SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00045
Plasmid#232904PurposePlasmid carrying MSN5 from LY00045 (S288C) with its native promoter and terminator.DepositorInsertMSN5 (MSN5 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 ILVtoED solvvol
Plasmid#231858PurposeBacterial expression of N-terminally 6His tagged Gcn4 ILVtoED solvvolDepositorInsertGcn4 ILVtoED solvvol
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterT7Available SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgSc-SeLEU2
Plasmid#224871PurposeDisruption of LEU2 genes in the Saccharomyces sense strict group speciesDepositorUseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB8156
Plasmid#175200PurposeXenopus oocyte expression vector containing yEGFP. Contains T7 RNA polymerase binding site, and adds polyA tail to yEGFP. Used for generation of mRNA, for injection into xenopus laevis oocytes.DepositorInsertyEGFP
UseMrna expression, injection into xenopus oocytesTagsPolyAPromoterT7Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEndo-I-OnuI-TSM
Plasmid#207954PurposeExpresses a fusion of the homing endonuclease I-OnuI with the thermosensitive L212P VMA1 intein. Endonuclease activity is restricted to lower temperatures.DepositorInsertThermosensitive fusion of I-OnuI and the L212P VMA1 intein.
UseSynthetic BiologyExpressionBacterialMutationLeucine 212 changed to proline, leucine 434 in fu…Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only