We narrowed to 10,784 results for: aav
-
Plasmid#118289PurposeExpresses mouse DYRK4 tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 (Dyrk4 Mouse)
UseAAVTags2A peptide and mCherryExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SF-Venus-iGluSnFR.S72A
Plasmid#106197PurposeWeak affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.S72A
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: S72APromoterGFAPAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV CB6 FFLuc
Plasmid#35655DepositorTypeEmpty backboneUseAAVAvailable SinceJuly 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ai14-luc
Plasmid#87118PurposeAAV backbone plasmid including luc-pA knock-in donor and Ai14gRNA for HITIDepositorInsertU6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA
UseAAV, CRISPR, and LuciferaseAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CaMKIIa::iLMO2
Plasmid#129481PurposeAAV2 transfer plasmid for iLMO2, an opto-chemogenetic probe for neuronal inhibition by light or chemical, under control of the glutamatergic-selective CaMKIIa promoterDepositorInsertiLMO2
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-NODALvar
Plasmid#115640PurposeFor targeted integration and inducible expression of a human NODAL splice variant using doxycyclineDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Donor/Reporter-COL4A3
Plasmid#130279PurposeCOL4A3 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A3 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.iAChSnFR-Venus-NULL
Plasmid#137953PurposeExpresses iAChSnFR (non-binding yellow version) under hSynapsin promoterDepositorArticleInsertiAChSnFR (yellow version, non-binding variant)
UseAAVExpressionMammalianMutationcpSFGFP replaced with cpSFVenus; Y140A binding si…PromoterhSynapsinAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
2ERT2-AAVS1 TALEN-L
Plasmid#120544PurposeDrug inducible TALEN targeting the human AAVS1 locus for genome editingDepositorInsertERT2, hAAVS1 1L TALEN
UseLentiviralExpressionMammalianPromoterEF1αAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgIdua.CMV/CB-EGFP
Plasmid#121511PurposeExpresses sgRNA targeting mouse Idua intron 9 (sgIdua).DepositorInsertsgIdua
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgAspa.CMV/CB-EGFP
Plasmid#121510PurposeExpresses sgRNA targeting mouse Aspa intron 2 (sgAspa).DepositorInsertsgAspa
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV asyn S129G
Plasmid#36067DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV2.5-THP-GFP/WGA
Plasmid#80337PurposeFluorescent Reporter for Dopaminergic Neuron DifferentiationDepositorAvailable SinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
paavCAG-post-mGRASP-2A-dTomato
Plasmid#34912PurposepostDepositorHas ServiceAAV5Insertpostsynaptic mGRASP
UseAAVPromoterCAGAvailable SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
paavCAG-pre-mGRASP-2A-dTomato
Plasmid#51902Purposepre-2AtoDepositorInsertpresynaptic mGRASP
UseAAV and Cre/LoxAvailable SinceJan. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgRNA
Plasmid#124844PurposeVector for Cre-dependent expression of SaCas9DepositorInsertSaCas9, gRNA scaffold
UseAAV, CRISPR, and Mouse TargetingTagsNLS and NLS-3xHAAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-NDi-CRISPRi (Gen2)
Plasmid#73498PurposeDox-inducible CRISPR interference (CRISPRi) knock in construct into the AAVS1 locusDepositorInsertsdCas9-KRAB
rtTA
UseCRISPRTagsHA, KRAB, and NLSExpressionMammalianMutationD10A, H840A (catalytically deactivated Cas9)PromoterCAG and TRE3GAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-42:AAVS1-mTagRFPT-CAAX
Plasmid#107580PurposeHomology arms, promoter and linker-mTagRFPT-CAAX sequence for internal insertion of CAGGS-driven mTagRFPT-CAAX at the AAVS1 safe harbor location in human cellsDepositorInsertAAVS1 Homology Arms with CAGGS-driven mTagRFPT-CAAX (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMay 9, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOTTC414 - pAAV EF1a hPREP
Plasmid#59967PurposeAn AAV packaging vector that expresses hPREP under control of the EF1a promoter.DepositorAvailable SinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only