We narrowed to 14,508 results for: SHR
-
Plasmid#233612PurposeExpression of guide RNA targeting the start codon of the Renilla luciferase gene for PspCas13bDepositorInsertgRNA targeting Renilla luciferase
UseCRISPRAvailable SinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA 2 GAPDH
Plasmid#83809PurposeExpress Sg-2 sgRNA targeting GAPDHDepositorInsertSgRNA
UseCRISPRAvailable SinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14107 fwYellow-targeting sgRNA
Plasmid#239456Purposeguide for fwYellowDepositorInsertguide targeting fwYellow
UseCRISPR; Cell-free system using bacterial extractExpressionBacterialPromoterJ23119Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14112 tyrosinase-targeting sgRNA
Plasmid#239751Purposeguide for tyrosinaseDepositorInsertguide targeting tyrosinase
UseCRISPR; Cell-free system using bacterial extractExpressionBacterialPromoterJ23119Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCJ1021
Plasmid#228761PurposePlasmid expressing Cas9 and 2 gRNAs for mouse Ift88. Use for disruption of mouse Ift88 in cultured cells.DepositorAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_EPHA2
Plasmid#183286PurposeAll-in-One CRISPRko system with a guide RNA that targets EPHA2 geneDepositorInsertEPHA2
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
1154B_gFLE_pB_VTK_ActG
Plasmid#187238PurposeAn. gambiae transgenesis plasmid. PiggyBac with transposase in backbone. Expresses two gRNAs targeting fleDepositorInsertFemaleless
UseCRISPRExpressionInsectAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-sgGOT1
Plasmid#72874PurposeThe lentiviral sgGOT1 vector was generated via ligation of hybridized oligos (below) into lentiCRISPR-v1 vector linearized with BsmBI using Gibson assembly (NEB).DepositorInsertsgGOT1
UseLentiviralAvailable SinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ERBB2
Plasmid#183287PurposeAll-in-One CRISPRko system with a guide RNA that targets ERBB2 geneDepositorInsertERBB2
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
TBP6.7 non-targeting gRNA lambda phage
Plasmid#132547Purposeexpresses gRNA for TBP-based CIRTSDepositorInsertgRNA TBP-based CIRTS
ExpressionMammalianPromoterhU6 promoterAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRDA_888
Plasmid#201165PurposeLentiviral expression of EnAsCas12a CRISPRa gRNA with N' nanobody-ALFA and C' p65, HSF1 and NLSDepositorInsertPuromycin resistance
UseCRISPR and LentiviralPromoterEFSAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mU6-GFPGO-IRES-mScarletI
Plasmid#136895PurposeLentivirus for base editing activatable GFP expression in mammalian cells. All-in-one vector with sgGO2.DepositorInsertGFPGO-IRES-mScarletI
UseLentiviralTags3xNLS on mScarletMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_PHF19_sgRNA
Plasmid#246404PurposeCas9/sgRNA expression plasmid targeting PHF19DepositorInsertPHF19 (PHF19 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY156: SUZ12 px330 sgRNA Cas9 plasmid
Plasmid#170792PurposeThis plasmid encodes Cas9 and a sgRNA that targets the SUZ12 locus; to be used with pDY153DepositorInsertCas9
ExpressionMammalianAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
p160Tol2-her4.3:switchCas9
Plasmid#227680PurposeExpression of cre inducible and her4.3 (Notch) dependent Cas9-GFP and U6-driven 4 sgRNAs for SABER-seq in zebrafishDepositorInsertsloxP-dsRed-loxP-Cas9-t2A-GFP
4xU6:sgRNA
UseCRISPRPromoterU6 and her4.3Available SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMM113
Plasmid#127210PurposeBeYDV replicon with constitutive Luc expression, WUS2 and AtSTM, sgRNA targeting PDSDepositorInsertWUS2, AtSTM, sgRNA, Luc
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pegRNA_GBA-4
Plasmid#199274PurposepegRNA used to correct GBA (c. 1226 A > G) mutationDepositorInsertGBA 1226GtoA pegRNA
ExpressionMammalianAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTlpA_mCherry_YafQ/DinJ
Plasmid#229148PurposeToxin-Antitoxin (Dinj/YafQ)DepositorInsertmCherry, DinJ/YafQ
ExpressionBacterialPromoterPtlpA (mCherry), DinJ/YafQ (Native)Available SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS dual_hspCas9
Plasmid#193312PurposeCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only