We narrowed to 14,335 results for: Ung;
-
Plasmid#53694PurposeLuciferase reporter assay for microRNA binding on E6AP 3'UTRDepositorInsertUBE3A 3'UTR (UBE3A Human)
UseLuciferaseAvailable SinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSHS325 - Bacterial expression plasmid for SpCas9 REC3 domain
Plasmid#101205PurposeBacterial expression plasmid for SpCas9 REC3 domainDepositorInsertSpCas9 variant K506–Q712
Tags10x His, MBP, and TEV siteExpressionBacterialMutationK506–Q712PromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag Snail 8SA
Plasmid#16222DepositorInsertSnail (SNAI1 Human)
TagsFlagExpressionMammalianMutation8SA: S97A, S101A, S105A, S108A, S112A, S116A, S12…Available SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
cmv hTid Short
Plasmid#13709DepositorInserthTid Short (DNAJA3 Human)
ExpressionMammalianAvailable SinceMarch 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO-EGFP-G3BP1-S149A
Plasmid#136004PurposeDOX-inducible S149A G3BP1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex SystemDepositorAvailable SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAcGP67A-hBAI3-HormR-GAIN
Plasmid#37848DepositorInsertBAI3 (BAI3 Human)
UseBaculovirus transfer vectorsTags8xHISMutationHormR and GAIN domains only (aa498–868PromoterPolyhedrinAvailable SinceJuly 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDC183
Plasmid#106415PurposeCo-expresses trans SNARE complex with pQZ210 in E. coliDepositorInsertsExpressionBacterialMutationFragment 141-204, Codon optimization and Fragment…PromoterT7Available SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP Snail 8SA
Plasmid#16229DepositorInsertSnail (SNAI1 Human)
TagsEGFPExpressionMammalianMutation8SA: S97A, S101A, S105A, S108A, S112A, S116A, S12…Available SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-CDS
Plasmid#136045PurposeUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter hsa-mir-128-1
Plasmid#46675DepositorInserthsa-mir-128-1 (MIR128-1 Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianPromoterCMVAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only