We narrowed to 6,182 results for: crispr cas9 expression plasmids
-
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax-SpRY
Plasmid#195279PurposeAllows for in vitro transcription of original pCMV-T7-ABEmax(7.10)-SpRY-P2A-EGFP (RTW5025) without EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpRY without EGFP
ExpressionMammalianPromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax-SpG
Plasmid#195278PurposeAllows for in vitro transcription of original pCMV-T7-ABEmax(7.10)-SpG-P2A-EGFP (RTW4562) without EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpG without EGFP
ExpressionMammalianPromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p2.13
Plasmid#246892PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for G3BP2 Nterm.DepositorInsertG3BP2 Nterm Guide RNA 1 (G3BP2 Human)
ExpressionMammalianAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Orco-T2A-QF2-9xQUAS-GCaMP6f-3XP3-dsRed
Plasmid#157974PurposeTemplate plasmid for inserting GCaMP reporter into the Orco gene of Aedes aegypti with CRISPR/Cas9DepositorInsertOrco
ExpressionInsectAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX4
Plasmid#183903Purposedonor plasmid for CRISPR Cas9 knockin near the Aedes aegypti m / M locusDepositorInsertGFP
ExpressionInsectPromoterAedes aegypti PUbAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gLacZ.EFS-NS.H2B-RFP
Plasmid#170363PurposeNegative control plasmid used for Crispr/cas9 based disruption. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceJune 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP
Plasmid#112677PurposeAn AAV vector that expresses a Cre-dependent nuclear-localized Red to Green Fluorescent proteinDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertNuclear-localized floxed-mCherry EGFP
UseAAVTagsNuclear localization signalPromoterEF1aAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 U6-SaAi9L-U6-SaAi9R
Plasmid#78604PurposeAAV vector containing gRNAs (for SaCas9) targeting Ai9 stop cassetteDepositorInsertgRNAs for SaCas9 targeting Ai9 locus
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM6-G6-vioABE-4A6-vioC-3A2-vioD
Plasmid#73440PurposeViolacein pathway (vioABECD) in monocistronic configuration, transcriptionally driven by orthogonal T7-lac promoter variants G6 (vioABE), 4A6 (vioC), and 3A2 (vioD) for orthogonal flux redirection.DepositorInsertPG6-vioABE-P4A6-vioC-P3A2-vioD
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPG6, P4A6, and P3A2 (orthogonal T7-lac variants)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p2.11
Plasmid#246891PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for G3BP1 Nterm.DepositorInsertG3BP1 Nterm Guide RNA 1 (G3BP1 Human)
ExpressionMammalianAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p2.16
Plasmid#246893PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for CAPRIN1 Nterm.DepositorInsertCaprin1 Nterm Guide RNA 1 (CAPRIN1 Human)
ExpressionMammalianAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
ABE7.10-F148A
Plasmid#132946PurposeGene editing. See Gene/Insert section of plasmid page for targeting sequence cloned into this plasmid.DepositorInsertABE7.10(F148A)
UseCRISPR; Base editorExpressionMammalianMutationABE7.10(F148A)Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
BE3-hA3A-R128A
Plasmid#132944PurposeGene editing. See Gene/Insert section of the plasmid page for targeting sequence cloned into this plasmid.DepositorInsertBE3-hA3A(R128A)
UseCRISPR; Base editorExpressionMammalianMutationBE3-hA3A(R128A)Available SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only