We narrowed to 6,414 results for: org
-
Plasmid#222922PurposePiggyBac transposon plasmid for doxycycline inducible expression of SOHLH1DepositorInsertSOHLH1 (SOHLH1 Human)
ExpressionMammalianAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBP-2_6m.mutant
Plasmid#162842PurposeYeast expression of the mutant #2_6m for the RNA-based sensor of fructose-1,6-bisphosphate #2_6DepositorInsert2_6m_RNA-device
ExpressionYeastAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Ptgfr
Plasmid#170303PurposeA knock-out vector for the mouse PtgfrDepositorInsertA gRNA targeting the mouse Ptgfr gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_CV2
Plasmid#167165PurposepgRNA_CV2 is derived from gRNA_cloning vector (Addgene plasmid ID: 41824) by adding about 80 bps from the sgRNA sequence as well as an AgeI site. In the literature, sgRNA_AL is used as an alias.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pSR11
Plasmid#69154Purposeread-outloxP mCherry to GFP switch, with fzr-1 promoter, gene and UTR, for integration on cxtTi10816, Mos Chr IVDepositorInsertsUseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterfzr-1 and rps-27Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD4_3
Plasmid#36376DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD4_2
Plasmid#36375DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (AAV9)
Viral Prep#100845-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (#100845). In addition to the viral particles, you will also receive purified pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 plasmid DNA. Syn-driven, Cre-dependent GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (AAV1)
Viral Prep#100833-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (#100833). In addition to the viral particles, you will also receive purified pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 plasmid DNA. Syn-driven, Cre-dependent GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (AAV9)
Viral Prep#100833-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (#100833). In addition to the viral particles, you will also receive purified pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 plasmid DNA. Syn-driven, Cre-dependent GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.GCaMP6s.WPRE.SV40 (AAV1)
Viral Prep#100842-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.Flex.GCaMP6s.WPRE.SV40 (#100842). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.GCaMP6s.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (AAV1)
Viral Prep#100845-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (#100845). In addition to the viral particles, you will also receive purified pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 plasmid DNA. Syn-driven, Cre-dependent GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (AAV5)
Viral Prep#100833-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (#100833). In addition to the viral particles, you will also receive purified pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 plasmid DNA. Syn-driven, Cre-dependent GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.GCaMP6s.WPRE.SV40 (AAV9)
Viral Prep#100842-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CAG.Flex.GCaMP6s.WPRE.SV40 (#100842). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.GCaMP6s.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (AAV5)
Viral Prep#100845-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (#100845). In addition to the viral particles, you will also receive purified pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 plasmid DNA. Syn-driven, Cre-dependent GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (AAV9)
Viral Prep#100835-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (#100835). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.GCaMP6m.WPRE.SV40 (AAV5)
Viral Prep#100839-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.CAG.Flex.GCaMP6m.WPRE.SV40 (#100839). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.GCaMP6m.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent GCaMP6m calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only