We narrowed to 7,549 results for: mag
-
Plasmid#104463PurposeMammalian expression of ultrasensitive protein calcium sensorDepositorInsertjGCaMP7s
TagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterCMVAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
mAC-POLR2A donor (Hygro)
Plasmid#124496PurposeA donor plasmid for tagging the N-terminus of human POLR2A with mAID-mCloverDepositorAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGP-CMV-jGCaMP7b
Plasmid#104484PurposeMammalian expression of ultrasensitive protein calcium sensorDepositorInsertjGCaMP7b
TagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterCMVAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC19_msfGFP-TCOF1-repair-template
Plasmid#237632PurposeFor knock-in msfGFP to TCOF1 locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-TCOF1-gRNA
Plasmid#237633PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to TCOF1 locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
5xUAS:GAP-mCherry-P2A-NfsB_Vv F70A/F108Y,he:tagBFP2
Plasmid#158653Purposemaking transgenics expressing a UAS driven mCherry and NTR 2.0DepositorInsert5xUAS:GAP-mCherry-P2A-NfsB_Vv F70A/F108Y;he:BFP
UseTol2-based transgenic expression in zebrafish/oth…MutationF70A/F108YAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-nSpCas9-P2A-EGFP (KAC978)
Plasmid#185910PurposepCMV and pT7 plasmid encoding human codon optimized ABE8e A-to-G base editor with nickase SpCas9(D10A) and P2A-EGFPDepositorInserthuman codon optimized ABE8e-nSpCas9-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9=D10APromoterCMV and T7Available SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I tension sensor (F40-based)
Plasmid#119186PurposeThe F40-based human desmoplakin I tension sensor detects forces in the range of 1-6 pN by changes in FRET between mTFP1 and mEYFP.DepositorInserthuman Desmoplakin I-[mTFP1-F40-mEYFP] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Akna-mEGFP
Plasmid#196866PurposeExpression of the centrosomal protein Akna fused to enhanced (E)-GFPDepositorInsertAkna-mEGFP (Akna Mouse)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLHCX-XBP1 mNeonGreen NLS
Plasmid#115971PurposeER-stress sensor - XBP1 splicing fluorescent reporter with mNeonGreen (retroviral vector backbone)DepositorInsertX-box binding protein 1 (XBP1 Synthetic, Human)
UseRetroviralTagsHA tag, c-myc NLS, and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I no force control (F40-based)
Plasmid#119187PurposeThe no force control for the F40-based human desmoplakin I tension sensor serves to detect changes in FRET between mTFP1 and mEYFP that are tension-independent.DepositorInserthuman Desmoplakinhuman Desmoplakin I (1-1945)-[mTFP1-F40-mEYFP] (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationtruncation after aa1945PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-NES-SomaFRCaMPi
Plasmid#232836PurposeAAV transfer plasmid for CAG-mediated Cre-dependent expression of soma-targeted FRCaMPiDepositorInsertNES-FRCaMPi
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterCAGAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/T0-Flag-RECQL5
Plasmid#222620PurposeMammalian expression vector of flag-tagged RECQL5DepositorAvailable SinceJuly 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLHCX-ATF4 mScarlet NLS
Plasmid#115970PurposeER-stress sensor - ATF4 translation at ORF3 fluorescent reporter with mScarlet-I (retroviral vector backbone)DepositorInsertactivating transcription factor 4 (ATF4 Synthetic, Human)
UseRetroviralTagsHA tag, c-myc NLS, and mScarlet-IExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ1A
Plasmid#65371PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertBAZ1A (BAZ1A Human)
TagsEmGFP and V5ExpressionMammalianMutation796I compared to all reference sequencesPromoterCMVAvailable SinceJune 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-UBR5
Plasmid#52050PurposeCMV driven mammalian expression of UBR5 with an N-termianl GFP fusionDepositorAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
5xQUAS:GAP-tagYFP-P2A-NfsB_Vv F70A/F108Y,he:ECFP
Plasmid#158654Purposemaking transgenics expressing a QUAS driven YFP and NTR 2.0DepositorInsert5xQUAS:GAP-tagYFP-P2A-NfsB_Vv F70A/F108Y;he:eCFP
UseTol2-based transgenic expression in zebrafish/oth…MutationF70A/F108YAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-ActinVhh-sfGFP-P2A-HA-tdiRFP-caax (JDW 1532)
Plasmid#242606PurposeA CAGGS driven expression vector containing an actin nanobody fused to sfGFP to label actin followed by a HA tagged tdiRFP fused to a caax tag to label the cell membrane.DepositorInsertActin Vhh-sfGFP-P2A-HA-tdiRFP-caax
ExpressionMammalianPromoterCAGGSAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7]K404R
Plasmid#200715PurposeThe plasmid expresses Myc-tagged FBW7 human isoform 1 with Lys404 to Arg mutation. Used for overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
TagsMycExpressionMammalianMutationFBW7 K404 is mutated to Alanine.PromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only