We narrowed to 7,386 results for: mag
-
Plasmid#242899PurposePiggyBac cargo vector with HNRNPK sgRNA 4 for dox-inducible knockdownDepositorAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only
-
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5E-hs_UbiC-pro (JDW 1461)
Plasmid#242547PurposeEnhancer/Promoter: Gateway 5' entry vector containing human Ubc promoter (-1225 to -6)DepositorInsertUbiquitin / Ubc promoter (UBC Human)
UseGateway subcloningAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_1
Plasmid#242897PurposePiggyBac cargo vector with HNRNPK sgRNA 1 for dox-inducible knockdownDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_3
Plasmid#242898PurposePiggyBac cargo vector with HNRNPK sgRNA 3 for dox-inducible knockdownDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-EGFP-Myc (JDW 1441)
Plasmid#242569PurposeGateway middle entry clone containing EGFP fused to oncogenic c-Myc.DepositorInsertc-Myc (MYC Human)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-pSyn_R-PTEN
Plasmid#227437PurposeExpression of the R-PTEN sensor under the Synapsin promoter in an AAV backboneDepositorInsertR-PTEN sensor (Pten Rat)
UseAAVTagsmCyRFP2 and mMaroonExpressionMammalianMutationR14GPromoterSynapsinAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-2
Plasmid#237635PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX1-KS
Plasmid#237679PurposeFor overexpression of mEGFP-SS18-SSX1-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX2-KS
Plasmid#237680PurposeFor overexpression of mEGFP-SS18-SSX2-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-1
Plasmid#237634PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-TCOF1-gRNA
Plasmid#237633PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to TCOF1 locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19_msfGFP-FUS-repair-tempate
Plasmid#237684PurposeFor knock-in msfGFP to FUS locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-Off_FLEX_Luc-P2A-H2A-mCherry (JDW 970)
Plasmid#229824PurposeA PiggyBac vector with a cre-dependent dual luciferase / nuclear mCherry reporter. In the presence of cre, this tet-off vector will be ubiquitously expressed in the absence of dox/tetDepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5E-Crestin-pro (JDW 1320)
Plasmid#229830PurposeA gateway compatible 5' entry clone containing the crestin gene followed by the mus musculus c Fos minimal promoter and then a rabbit beta globin intron to drive neural crest-specific gene expressionDepositorInsertCrestin promoter, c-fos minimal promoter, and b-globin intron
UseGateway entry cloneAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-FLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
Plasmid#220609PurposeNeuron-specific, Cre-dependent co-expression of FLAG-tagged inhibitory hM4D(Gi) DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporter.DepositorInsertFLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterhSynAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304-BCL-XL-F97W
Plasmid#203572PurposeExpresses V5-tagged BCL-XL with partial drug resistance to A-1331852 in mammalian cells.DepositorInsertBCL2L1 (BCL2L1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationChanged Phenylalanine 97 to Tryptophan for partia…PromoterCMVAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 7 deletion
Plasmid#224388PurposeLenti plasmid for generating GNB1L _WD 7 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
ExpressionBacterial and MammalianMutationWD 7 domain deleted (aa 286-323)Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 6 deletion
Plasmid#224387PurposeLenti plasmid for generating GNB1L _WD 6 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
ExpressionBacterial and MammalianMutationWD 6 domain deleted (aa 242-282)Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 4 deletion
Plasmid#224385PurposeLenti plasmid for generating GNB1L _WD 4 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
ExpressionBacterial and MammalianMutationWD 4 domain deleted (aa 153-195)Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only