335,500 results
-
Plasmid#127851Purposenon-standard AAV2 rep-AAV-PHP.N cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.N VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-hChR2-H134R-tdTomato (AAV Retrograde)
Viral Prep#28017-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-CAG-hChR2-H134R-tdTomato (#28017). In addition to the viral particles, you will also receive purified AAV-CAG-hChR2-H134R-tdTomato plasmid DNA. Humanized channelrhodopsin H134R mutant fused to tdTomato, under the control of the CAG promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomatoAvailable SinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDB4695
Plasmid#171127PurposeA plasmid containing the codon-optimized OsTIR1-F74A, which is under the control of adh1 promoter. It served as one of the F-box protein expression plasmids in AID system.DepositorInsertOsTIR1-F74A
UseOtherMutationnon applicableAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-3XHA-TMEM192
Plasmid#104434PurposeExpresses 3XHA-TMEM192 in mammalian cellsDepositorAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBBR8k-GFPuv
Plasmid#106385PurposeL-arabinose-inducible araBAD promoter expressing gfpuv on BBR1 originDepositorInsertGFPuv
ExpressionBacterialPromoteraraBADAvailable SinceMarch 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF5B-FRT-GFP-αTAT1
Plasmid#27099DepositorInsertα-Tubulin K40 acetyltransferase1 (ATAT1 Human)
TagsGFP, S-tag, and TEV siteExpressionMammalianPromoterEF1aAvailable SinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) CircRNA Mini Vector
Plasmid#60648PurposeExpression plasmid for expressing circular RNAs of a desired sequenceDepositorAvailable SinceOct. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cas3
Plasmid#209427PurposePlasmid for CASCADE-Cas3 based genome engineering of streptomycetesDepositorInsertcodon optimized minimal type I-C CASCADE-Cas3 from Pseudomonas aeruginosa
UseCRISPR and Synthetic BiologyPromoterPtipA; crRNA under control of PermE*Available SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-G3BP1-WT
Plasmid#135997PurposeWT G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cellsDepositorAvailable SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-p53_wt p53
Plasmid#22945Purpose3rd generation lentiviral vector encoding human p53 with a C-terminal V5 tagDepositorAvailable SinceJan. 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
EF1a-TET1-dCas9
Plasmid#235593PurposeTet1CD fused to N-terminus of dCas9DepositorInsertTET1-dCas9 (TET1 Human, SpCas9 is from Streptococcus pyogenes)
UseCRISPRTags3xNLS, TET1 CD, and tagBFPExpressionMammalianPromoterEF1aAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICH47772
Plasmid#48004DepositorTypeEmpty backboneUseUnspecifiedAvailable SinceDec. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pT4/HB
Plasmid#108352PurposeOptimized Sleeping Beauty Transposon Vector with MCSDepositorTypeEmpty backboneUseTransposonAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-gRNA-CBh-mCherry
Plasmid#91947PurposeExpression of empty gRNA cassette and mCherryDepositorInsertmCherry
UseAAVAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEF1-Pls3-sfGFP
Plasmid#205750PurposeExpresses sfGFP under IPTG inducible promoter Pls3 in high copy pTRKH2 gram-positive shuttle vector. Used in Lactobacillus gasseri. Medium/High strength.DepositorTypeEmpty backboneUseShuttle vector gram+ gram-ExpressionBacterialPromoterPls3 (Phyperspank mutant, IPTG inducible)Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTW1169
Plasmid#236583PurposeTRV1DepositorInsertTRV1
ExpressionPlantAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
ER-mNeonGreen
Plasmid#137804PurposeVisualization of the Endoplasmic ReticulumDepositorInsertKDEL
ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-DIO-TC66T-2A-EGFP-2A-oG
Plasmid#178429PurposeExpresses TVA(TC66T), EGFP, and optimized Rabies G (oG) protein in a FLEX cassetteDepositorInsertsTVA950 Glu66→Thr
Optimized G
EGFP
UseAAV and Cre/Lox; Adeno-associated virusPromoterhSynAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
FLAG-JAK1
Plasmid#174572PurposeHuman FLAG-tagged JAK1 expression (N-term. tag) (CMV prom.)DepositorAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only