We narrowed to 25,670 results for: promoter
-
Plasmid#154461PurposeExpression of SEAP and firefly luciferaseDepositorInsertSEAP
Available SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-P2A-EGFP (RTW3027)
Plasmid#139987PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9 with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 3xHA-KillerRed-OMP25
Plasmid#174544Purposelocalizes KillerRed to mitochondriaDepositorInsert3xHA-KillerRed-OMP25
UseLentiviralExpressionMammalianAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_Dual_sgRNA
Plasmid#178104PurposeCoselection for PE3 in human cells. Vector for tandem expression of ATP1A1 G8 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G8 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HIVGKO
Plasmid#112234PurposeHIVGKO contains a codon-switched eGFP under the control of the HIV-1 specific promoter, and mKO2 under the control of the constitutive promoter EF1aDepositorInsertcsGFP-EF1a-mKO2
UseLentiviralAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
LBR-mCherry
Plasmid#172446PurposeExpression of nuclear envelope protein LBR with a C-terminal mCherry tagDepositorAvailable SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDESTN-MTp-p53-Venus
Plasmid#53736PurposeExpresses Venus tagged p53 under the metallothionein promoterDepositorAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLVET-IRES-GFP
Plasmid#107139PurposeA bicistronic lentiviral mammalian expression vector with a multiple cloning site and GFPDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-puro-ARID1A
Plasmid#39478PurposeTetracycline-inducible lentiviral expression of human ARID1A; 3rd generation lentiviral vectorDepositorAvailable SinceSept. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRPN265NB-enh-MNase
Plasmid#166035PurposeExpresses a nanobody against GFP fused to micrococcal nuclease for purposes of green Cut & RunDepositorInsertGlutathione-S-Transferase/enhancer/MNase
TagsGSTExpressionBacterialPromoterlac promoter / tac promoterAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_Lambda-N-HA-Peptide
Plasmid#92005PurposeExpresses Lambda-N-HA peptideDepositorInsertLambda-N-HA peptide
TagsLambda-N-HAExpressionMammalianAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.R_TRE_minCMV
Plasmid#211518PurposeDual-luciferase reporter plasmid backbone for insertion of your TRE of interest driving minCMV-luc2P expression in addition to constitutive SV-40-driven Renilla luciferase expressionDepositorTypeEmpty backboneExpressionBacterialPromoterSV40 and minCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Pur-CAG-hM4Di-mCherry
Plasmid#80947Purposehuman AAVS1 site targeting donor plasmid for knock-in hM4Di-mCherry expression cassette driven by CAG promoterDepositorInserthM4Di-mCherry
Tagsmcherry fusionExpressionMammalianPromoterCAG promoterAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZW6 (CK2alpha)
Plasmid#27086DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
HA-TAZ
Plasmid#32839DepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(EF1a)
Plasmid#172326PurposeLV REPORT containing minimal promoter driving monomeric nuclear Tomato followed by an EF1a promoter driving nuclear d2eGFP E2A HygromycinDepositorInsertsmonomeric nuclear Tomato
d2eGFP
HygR
UseLentiviral and Synthetic BiologyTags3x SV40 NLSExpressionMammalianPromoterEF1-alphaAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
REEP5-EGFP
Plasmid#210363PurposeExpresses REEP5 fused with EGFP in mammalian cellsDepositorAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.R_TRE_minPro
Plasmid#211517PurposeDual-luciferase reporter plasmid backbone for insertion of your TRE of interest driving minPro-luc2P expression in addition to constitutive SV-40-driven Renilla luciferase expressionDepositorTypeEmpty backboneExpressionBacterialPromoterSV40 and minProAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
HBV 1.3-mer X-null replicon
Plasmid#65461Purposecontaining 1.3 units of the X-null HBV genome (subtype ayw)DepositorInsert1.3 units of the X-null HBV genome
ExpressionMammalianAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only