We narrowed to 52,501 results for: KAN;
-
Plasmid#63718PurposeVoltage sensing domain of Ciona with the D136S/R168H/T193P/V220R mutations fused to super ecliptic pHlorin A227DDepositorInsertCC6
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
CC5
Plasmid#63717PurposeVoltage sensing domain of Ciona with the D129N/D164N/G187A/V220T mutations fused to super ecliptic pHlorin A227DDepositorInsertCC5
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
CC4
Plasmid#63716PurposeVoltage sensing domain of Ciona with the D129S/R168A/D186S/R229I mutations fused to super ecliptic pHlorin A227DDepositorInsertCC4
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
CC2
Plasmid#63714PurposeVoltage sensing domain of Ciona with the D136A/A154D/E183N/R223Q mutations fused to super ecliptic pHlorin A227DDepositorInsertCC2
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
CC3
Plasmid#63715PurposeVoltage sensing domain of Ciona with the G122A/D164A/D186A/R217Q/R229I mutations fused to super ecliptic pHlorin A227DDepositorInsertCC3
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGAD-hPLEKHM1
Plasmid#64145PurposeFor yeast two hybridDepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGMCK-0X750-luxAB-DAS+4
Plasmid#49517PurposeKanamycin resistant; expresses luxAB-DAS+4 under the control of a promoter containing PtetO-4C5G; integrates into the mycobacteriophage att-L5 siteDepositorInsertP750-luxAB-DAS+4
TagsDAS+4 (AANDENYSENYADAS)ExpressionBacterialPromoterP750Available SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
CFP-GAI(1-151)
Plasmid#37308DepositorAvailable SinceJune 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pYL156 (TRV RNA2)
Plasmid#148969PurposeModified Tobacco Rattle Virus RNA 2; used for virus induced gene silencing in plants along with pYL192 (TRV RNA1)DepositorInsertModified TRV RNA2
UseT-dna vectorMutationsee comments section belowAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_22C
Plasmid#91135PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:npt IIDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
FLuc-C-NLuc
Plasmid#234566PurposeBacterially expressed FLuc-C-NLuc for Ni-NTA purificationDepositorInsertFirefly luciferase
TagsNanoLuciferase-thrombin site-10xHis and T7 gene 1…ExpressionBacterialMutationCodon optmization for expression in BL21DE3PromoterT7Available SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pK18msB
Plasmid#177839PurposePlasmid for gene replacement using kanamycin/sucrose selection/counterselection. Derived from pK18mobsacB but reduced in size.DepositorTypeEmpty backboneUseBacterial gene replacementAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1365 LV EF1a-CD28 IRES-EGFP
Plasmid#201921Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD28DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Vamp2-pHluorin
Plasmid#190151PurposeExpresses (pH-sensitive) super ecliptic pHluorin-tagged mouse/rat Vamp2 for imaging exocytosisDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_NSlmb-vhhGFP4
Plasmid#35579DepositorInsertNSlmb-vhhGFP4 (slmb Fly)
ExpressionMammalianAvailable SinceApril 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV7.1_3xFLAG-MOB1A
Plasmid#172988Purposeconstitutive expression of FLAG-tagged MOB1ADepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX303
Plasmid#25897Purpose3rd generation lentiviral Gateway destination vector. Blasticidin selection.DepositorTypeEmpty backboneUseLentiviral; Gateway destination vectorExpressionMammalianAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV mGAD65(delE1) GFP WPRE SV40pA
Plasmid#177316PurposeTo produce the AAV vector that expresses GFP under the control of the mGAD65 promoter. The mGAD65 promoter has highly specificity to GABAergic interneurons.DepositorInsertmGAD65(delE1) promoter, GABAergic interneurons specific promoter
UseAAVAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_18xTEAD_luc2
Plasmid#173003Purposefirefly luciferase reporter vector with 18x clustered TEAD binding sitesDepositorInsert18xTEAD-luc2
UseAAV and LuciferaseExpressionMammalianAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only